Metadata-Version: 2.1
Name: codext
Version: 1.4.4
Summary: Native codecs extension
Home-page: https://github.com/dhondta/python-codext
Author: Alexandre D'Hondt
Author-email: alexandre.dhondt@gmail.com
License: AGPLv3
Description: [![PyPi](https://img.shields.io/pypi/v/codext.svg)](https://pypi.python.org/pypi/codext/)
        [![Read The Docs](https://readthedocs.org/projects/python-codext/badge/?version=latest)](https://python-codext.readthedocs.io/en/latest/?badge=latest)
        [![Build Status](https://travis-ci.org/dhondta/python-codext.svg?branch=master)](https://travis-ci.org/dhondta/python-codext)
        [![Coverage Status](https://coveralls.io/repos/github/dhondta/python-codext/badge.svg?branch=master)](https://coveralls.io/github/dhondta/python-codext?branch=master)
        [![Python Versions](https://img.shields.io/pypi/pyversions/codext.svg)](https://pypi.python.org/pypi/codext/)
        [![Requirements Status](https://requires.io/github/dhondta/python-codext/requirements.svg?branch=master)](https://requires.io/github/dhondta/python-codext/requirements/?branch=master)
        [![Known Vulnerabilities](https://snyk.io/test/github/dhondta/python-codext/badge.svg?targetFile=requirements.txt)](https://snyk.io/test/github/dhondta/python-codext?targetFile=requirements.txt)
        [![License](https://img.shields.io/pypi/l/codext.svg)](https://pypi.python.org/pypi/codext/)
        
        # Codecs Extension
        
        This library extends the native `codecs` library and provides some new encodings (static or parametrized, like `rot-N` or `xor-N`).
        
        **Codec** | **Conversions** | **Comment**
        :---: | :---: | ---
        `affine` | Affine <-> text | aka Affine Cipher
        `ascii85` | Ascii85 <-> text | Python 3 only
        `atbash` | Atbash <-> text | aka Atbash Cipher
        `bacon` | Bacon <-> text | aka Baconian Cipher
        `barbie-N` | Barbie <-> text | aka Barbie Typewriter (N belongs to [1, 4])
        `baseXX` | BaseXX <-> text | see [base encodings](https://python-codext.readthedocs.io/en/latest/base.html)
        `braille` | braille <-> text | Python 3 only
        `dna-N` | DNA-N <-> text | implements the 8 rules of DNA sequences (N belongs to [1,8])
        `leetspeak` | leetspeak <-> text | based on minimalistic elite speaking rules
        `markdown` | markdown --> HTML | unidirectional
        `morse` | morse <-> text | uses whitespace as a separator
        `nokia3310` | Nokia 3310 keystrokes <-> text | uses "`-`" as a separator for encoding, "`-`" or "`_`" or whitespace for decoding
        `ordinals` | Ordinals <-> text | dummy character ordinals conversion
        `radio` | Radio <-> text | aka NATO or radio phonetic alphabet
        `resistor` | Resistor <-> text | aka resistor color codes
        `rot-N` | ROT(N) <-> text | aka Caesar cipher (N belongs to [1,25])
        `shift` | shift(N) <-> text | shift ordinals with N (belongs to [1,255])
        `url` | URL <-> text | aka URL encoding
        `xor-N` | XOR(N) <-> text | XOR with a single byte (N belongs to [1,255])
        `whitespace` | Whitespaces <-> text | replaces bits with whitespaces and tabs
        
        
        ## Setup
        
        This library is available on [PyPi](https://pypi.python.org/pypi/codext/) and can be simply installed using Pip:
        
        ```sh
        $ pip install codext
        ```
        
        or
        
        ```sh
        $ pip3 install codext
        ```
        
        **Note**: Some more encodings are available when installing in Python 3.
        
        ## Usage (from terminal)
        
        ```sh
        $ codext dna-1 -i test.txt
        GTGAGCGGGTATGTGA
        $ echo -en "test" | codext morse
        - . ... -
        ```
        
        Python 3 (includes Ascii85, Base85, Base100 and braille):
        
        ```sh
        $ echo -en "test" | codext braille
        ⠞⠑⠎⠞
        $ echo -en "test" | codext base100
        👫👜👪👫
        ```
        
        ## Usage (within Python)
        
        Example with Base58:
        
        ```python
        >>> codext.encode("this is a test", "base58-bitcoin")
        'jo91waLQA1NNeBmZKUF'
        >>> codext.encode("this is a test", "base58-ripple")
        'jo9rA2LQwr44eBmZK7E'
        >>> codext.encode("this is a test", "base58-url")
        'JN91Wzkpa1nnDbLyjtf'
        ```
        
        Example with Base100 (emoji's):
        
        ```python
        >>> codecs.encode("this is a test", "base100")
        '👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫'
        >>> codecs.decode("👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫", "base100")
        'this is a test'
        ```
        
        Example with DNA sequence encoding:
        
        ```python
        >>> for i in range(8):
                print(codext.encode("this is a test", "dna-%d" % (i + 1)))
        GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA
        CTCACGGACGGCCTATAGAACGGCCTATAGAACGACAGAACTCACGCCCTATCTCA
        ACAGATTGATTAACGCGTGGATTAACGCGTGGATGAGTGGACAGATAAACGCACAG
        AGACATTCATTAAGCGCTCCATTAAGCGCTCCATCACTCCAGACATAAAGCGAGAC
        TCTGTAAGTAATTCGCGAGGTAATTCGCGAGGTAGTGAGGTCTGTATTTCGCTCTG
        TGTCTAACTAATTGCGCACCTAATTGCGCACCTACTCACCTGTCTATTTGCGTGTC
        GAGTGCCTGCCGGATATCTTGCCGGATATCTTGCTGTCTTGAGTGCGGGATAGAGT
        CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
        >>> codext.decode("GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA", "dna-1")
        'this is a test'
        ```
        
        Example with morse:
        
        ```python
        >>> codecs.encode("this is a test", "morse")
        '- .... .. ... / .. ... / .- / - . ... -'
        >>> codecs.decode("- .... .. ... / .. ... / .- / - . ... -", "morse")
        'this is a test'
        >>> with open("morse.txt", 'w', encoding="morse") as f:
        	f.write("this is a test")
        14
        >>> with open("morse.txt",encoding="morse") as f:
        	f.read()
        'this is a test'
        ```
        
Keywords: python,development,programming,codecs,encodings
Platform: UNKNOWN
Classifier: Development Status :: 5 - Production/Stable
Classifier: Environment :: Console
Classifier: Intended Audience :: Developers
Classifier: License :: OSI Approved :: GNU Affero General Public License v3 or later (AGPLv3+)
Classifier: Programming Language :: Python :: 2
Classifier: Programming Language :: Python :: 2.7
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: Python :: 3.5
Classifier: Programming Language :: Python :: 3.6
Classifier: Programming Language :: Python :: 3.7
Classifier: Programming Language :: Python :: 3.8
Classifier: Topic :: Software Development :: Libraries :: Python Modules
Requires-Python: !=3.0.*,!=3.1.*,!=3.2.*,!=3.3.*!=3.4.*,<4,>=2.7
Description-Content-Type: text/markdown
