Metadata-Version: 2.1
Name: easy_prime
Version: 1.1.2
Summary: Prime editor gRNA design tool
Home-page: https://github.com/YichaoOU/easy_prime
Author: Yichao Li
Author-email: Yichao.Li@stjude.org
License: LICENSE
Description: [![Version][version-shield]][version-url]
        [![Python versions][python-shield]][python-url]
        [![Platforms][platform-shield]][python-url]
        
        # Easy-Prime: an optimized prime editor gRNA design tool based on gradient boosting trees
        
        Easy-Prime provides optimized pegRNA and ngRNA combinations for efficient Prime editing design.
        
        # Summary
        
        PE design involves carefully choosing a standard sgRNA, a RT template that contains the desired edits, a PBS that primes the RT reaction, and a ngRNA that nicks the non-edit strand. Usually thousands of combinations are available for one single disired edit. Therefore, it is overwhelming to select the most likely high-efficient candidate from the huge number of combinations.
        
        Easy-Prime applies a machine learning model (i.e., XGboost) that learned important PE design features from public PE amplicon sequencing data to help researchers selecting the best candidate.
        
        # Installation
        
        The most easiest way to install Easy-Prime is via conda.
        
        ```
        
        conda create -n genome_editing -c liyc1989 easy_prime
        
        source activate genome_editing
        
        easy_prime -h
        
        ```
        
        # Usage
        
        ```
        
        git clone https://github.com/YichaoOU/easy_prime
        
        cd easy_prime/test
        
        easy_prime -h
        
        easy_prime --version
        
        ## Please update the genome_fasta in config.yaml 
        
        easy_prime -c config.yaml -f test.vcf
        
        ## Will output results to a folder
        
        ```
        
        Easy-Prime also provides a dash application.
        
        ```
        
        git clone https://github.com/YichaoOU/easy_prime
        
        cd easy_prime/dash_app
        
        python main.py
        
        ```
        
        ![screenshot](screenshot.png)
        
        # Input
        
        A vcf file containing at least 5 columns. See `test/test.vcf` for examples.
        
        
        ## Searching parameters for PE design
        
        Default values are shown in the following yaml files.
        
        ```yaml
        
        genome_fasta: /path/to/genome.fa
        scaffold: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC
        debug: 0
        n_jobs: 4
        min_PBS_length: 8
        max_PBS_length: 17
        min_RTT_length: 10
        max_RTT_length: 25
        min_distance_RTT5: 3
        max_ngRNA_distance: 100
        max_target_to_sgRNA: 10
        sgRNA_length: 20
        offset: -3
        PAM: NGG
        
        ```
        
        # Output
        
        The output folder contains:
        
        - topX_pegRNAs.csv
        - rawX_pegRNAs.csv.gz
        - X_p_pegRNAs.csv.gz
        - summary.csv
        
        The top candidates are provided in `topX_pegRNAs.csv`. This is a rawX format file. 
        
        ## rawX format
        
        X means the input to machine learning models. Here, rawX basically means the file before machine learning featurization. Specifically, rawX contains 11 + 1 columns. The first 5 columns are from the input vcf file: sample_ID, chr, pos, ref, alt, where sample_ID ends with `_candidate_xxx`, this indicates the N-th combination. The next 6 columns are genomic coordinates: type, seq, chr, start, end, strand, where the `type` could be sgRNA, PBS, RTT, or ngRNA. Since for one PE design, it has to have these 4 components, which means that for one unique `sample_ID`, it has 4 rows specifying the sequences for each of them. The 12-th column, which is optional, is the predicted efficiency; in other words, the Y for machine learning.
        
        Both `topX_pegRNAs.csv` and `rawX_pegRNAs.csv.gz` use this format.
        
        ## X format
        
        X format is the numeric representation of rawX. `X_p` format appends the predicted efficiency to the last column of X.
        
        ## Main results
        
        The main results, which is the top condidates, is provided in `topX_pegRNAs.csv`.
        
        # PE design visualization
        
        Users can visualize the predicted combinations using:
        
        ```bash
        
        easy_prime_vis -f topX_pegRNAs.csv -s /path/to/genome_fasta.fa
        
        ```
        
        This will output pdf files to a result dir. 
        
        [version-shield]: https://img.shields.io/conda/v/liyc1989/easy_prime.svg
        [version-url]: https://anaconda.org/liyc1989/easy_prime
        [python-shield]: https://img.shields.io/pypi/pyversions/easy_prime.svg
        [python-url]: https://pypi.python.org/pypi/easy_prime
        [platform-shield]: https://anaconda.org/liyc1989/easy_prime/badges/platforms.svg
        
        
Keywords: prime editor
Platform: UNKNOWN
Classifier: Development Status :: 5 - Production/Stable
Classifier: Intended Audience :: Science/Research
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Classifier: Topic :: Scientific/Engineering :: Visualization
Classifier: Topic :: Scientific/Engineering :: Information Analysis
Classifier: Operating System :: Unix
Classifier: Natural Language :: English
Classifier: Programming Language :: Python :: 3
Description-Content-Type: text/markdown
