Metadata-Version: 2.1
Name: codext
Version: 1.8.1
Summary: Native codecs extension
Home-page: https://github.com/dhondta/python-codext
Author: Alexandre D'Hondt
Author-email: alexandre.dhondt@gmail.com
License: GPLv3
Description: [![PyPi](https://img.shields.io/pypi/v/codext.svg)](https://pypi.python.org/pypi/codext/)
        [![Read The Docs](https://readthedocs.org/projects/python-codext/badge/?version=latest)](https://python-codext.readthedocs.io/en/latest/?badge=latest)
        [![Build Status](https://travis-ci.org/dhondta/python-codext.svg?branch=master)](https://travis-ci.org/dhondta/python-codext)
        [![Coverage Status](https://coveralls.io/repos/github/dhondta/python-codext/badge.svg?branch=master)](https://coveralls.io/github/dhondta/python-codext?branch=master)
        [![Python Versions](https://img.shields.io/pypi/pyversions/codext.svg)](https://pypi.python.org/pypi/codext/)
        [![Requirements Status](https://requires.io/github/dhondta/python-codext/requirements.svg?branch=master)](https://requires.io/github/dhondta/python-codext/requirements/?branch=master)
        [![Known Vulnerabilities](https://snyk.io/test/github/dhondta/python-codext/badge.svg?targetFile=requirements.txt)](https://snyk.io/test/github/dhondta/python-codext?targetFile=requirements.txt)
        [![License](https://img.shields.io/pypi/l/codext.svg)](https://pypi.python.org/pypi/codext/)
        
        ## Introduction
        
        This library extends the native [`codecs`](https://docs.python.org/3/library/codecs.html) library (namely for adding new custom encodings and character mappings) and provides a myriad of new encodings (static or parametrized, like `rot` or `xor`), hence its named combining *CODecs EXTension*.
        
        ## Setup
        
        ```sh
        $ pip install codext
        ```
        
        **Note**: Some encodings are available in Python 3 only.
        
        ## Usage (CLI tool)
        
        ```sh
        $ codext -i test.txt encode dna-1
        GTGAGCGGGTATGTGA
        $ echo -en "test" | codext encode morse
        - . ... -
        ```
        
        Python 3 (includes Ascii85, Base85, Base100 and braille):
        
        ```sh
        $ echo -en "test" | codext encode braille
        ⠞⠑⠎⠞
        $ echo -en "test" | codext encode base100
        👫👜👪👫
        ```
        
        Using codecs chaining:
        
        ```sh
        $ echo -en "Test string" | codext encode reverse
        gnirts tseT
        $ echo -en "Test string" | codext encode reverse morse
        --. -. .. .-. - ... / - ... . -
        $ echo -en "Test string" | codext encode reverse morse dna-2
        AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC
        $ echo -en "Test string" | codext encode reverse morse dna-2 octal
        101107124103101107124103101107124107101107101101101107124103101107124107101107101101101107124107101107124107101107101101101107124107101107124103101107124107101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124124101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124107101107101101101107124103
        $ echo -en "AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC" | codext -d dna-2 morse reverse
        test string
        ```
        
        ## Usage (Python)
        
        Getting the list of available codecs:
        
        ```python
        >>> import codext
        >>> codext.list()
        ['ascii85', 'base85', 'base100', 'base122', ..., 'tomtom', 'dna', 'html', 'markdown', 'url', 'resistor', 'sms', 'whitespace', 'whitespace-after-before']
        ```
        
        Usage examples:
        
        ```python
        >>> codext.encode("this is a test", "base58-bitcoin")
        'jo91waLQA1NNeBmZKUF'
        >>> codext.encode("this is a test", "base58-ripple")
        'jo9rA2LQwr44eBmZK7E'
        >>> codext.encode("this is a test", "base58-url")
        'JN91Wzkpa1nnDbLyjtf'
        ```
        
        ```python
        >>> codecs.encode("this is a test", "base100")
        '👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫'
        >>> codecs.decode("👫👟👠👪🐗👠👪🐗👘🐗👫👜👪👫", "base100")
        'this is a test'
        ```
        
        ```python
        >>> for i in range(8):
                print(codext.encode("this is a test", "dna-%d" % (i + 1)))
        GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA
        CTCACGGACGGCCTATAGAACGGCCTATAGAACGACAGAACTCACGCCCTATCTCA
        ACAGATTGATTAACGCGTGGATTAACGCGTGGATGAGTGGACAGATAAACGCACAG
        AGACATTCATTAAGCGCTCCATTAAGCGCTCCATCACTCCAGACATAAAGCGAGAC
        TCTGTAAGTAATTCGCGAGGTAATTCGCGAGGTAGTGAGGTCTGTATTTCGCTCTG
        TGTCTAACTAATTGCGCACCTAATTGCGCACCTACTCACCTGTCTATTTGCGTGTC
        GAGTGCCTGCCGGATATCTTGCCGGATATCTTGCTGTCTTGAGTGCGGGATAGAGT
        CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
        >>> codext.decode("GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA", "dna-1")
        'this is a test'
        ```
        
        ```python
        >>> codecs.encode("this is a test", "morse")
        '- .... .. ... / .. ... / .- / - . ... -'
        >>> codecs.decode("- .... .. ... / .. ... / .- / - . ... -", "morse")
        'this is a test'
        >>> with open("morse.txt", 'w', encoding="morse") as f:
        	f.write("this is a test")
        14
        >>> with open("morse.txt",encoding="morse") as f:
        	f.read()
        'this is a test'
        ```
        
        ```python
        >>> codext.decode("""
              =            
                      X         
           :            
              x         
          n  
            r 
                y   
              Y            
                      y        
             p    
                 a       
         `          
                    n            
                  |    
          a          
        o    
               h        
                  `            
                  g               
                   o 
           z      """, "whitespace-after+before")
        'CSC{not_so_invisible}'
        ```
        
        ```python
        >>> print(codext.encode("An example test string", "baudot-tape"))
        ***.**
           . *
        ***.* 
        *  .  
           .* 
        *  .* 
           . *
        ** .* 
        ***.**
        ** .**
           .* 
        *  .  
        * *. *
           .* 
        * *.  
        * *. *
        *  .  
        * *.  
        * *. *
        ***.  
          *.* 
        ***.* 
         * .* 
        ```
        
        ## List of codecs
        
        **Codec** | **Conversions** | **Comment**
        :---: | :---: | ---
        `a1z26` | text <-> alphabet order numbers | keeps words whitespace-separated and uses a custom character separator
        `affine` | text <-> affine ciphertext | aka Affine Cipher
        `ascii85` | text <-> ascii85 encoded text | Python 3 only
        `atbash` | text <-> Atbash ciphertext | aka Atbash Cipher
        `bacon` | text <-> Bacon ciphertext | aka Baconian Cipher
        `barbie-N` | text <-> barbie ciphertext | aka Barbie Typewriter (N belongs to [1, 4])
        `baseXX` | text <-> baseXX | see [base encodings](https://python-codext.readthedocs.io/en/latest/enc/base.html)
        `baudot` | text <-> Baudot code bits | supports CCITT-1, CCITT-2, EU/FR, ITA1, ITA2, MTK-2 (Python3 only), UK, ...
        `bcd` | text <-> binary coded decimal text | encodes characters from their (zero-left-padded) ordinals
        `braille` | text <-> braille symbols | Python 3 only
        `citrix` | text <-> Citrix CTX1 ciphertext | aka Citrix CTX1 passord encoding
        `dna` | text <-> DNA-N sequence | implements the 8 rules of DNA sequences (N belongs to [1,8])
        `excess3` | text <-> XS3 encoded text | uses Excess-3 (aka Stibitz code) binary encoding to convert characters from their ordinals
        `gray` | text <-> gray encoded text | aka reflected binary code
        `gzip` | text <-> Gzip-compressed text | standard Gzip compression/decompression
        `html` | text <-> HTML entities | implements entities according to [this reference](https://dev.w3.org/html5/html-author/charref)
        `ipsum` | text <-> latin words | aka lorem ipsum
        `leetspeak` | text <-> leetspeak encoded text | based on minimalistic elite speaking rules
        `letter-indices` | text <-> text with letter indices | encodes consonants and/or vowels with their corresponding indices
        `manchester` | text <-> manchester encoded text | XORes each bit of the input with `01`
        `markdown` | markdown --> HTML | unidirectional
        `morse` | text <-> morse encoded text | uses whitespace as a separator
        `navajo` | text <-> Navajo | only handles letters (not full words from the Navajo dictionary)
        `octal` | text <-> octal digits | dummy octal conversion (converts to 3-digits groups)
        `ordinal` | text <-> ordinal digits | dummy character ordinals conversion (converts to 3-digits groups)
        `radio` | text <-> radio words | aka NATO or radio phonetic alphabet
        `resistor` | text <-> resistor colors | aka resistor color codes
        `rot` | text <-> rot(N) ciphertext | aka Caesar cipher (N belongs to [1,25])
        `rotate` | text <-> N-bits-rotated text | rotates characters by the specified number of bits
        `scytale` | text <-> scytale ciphertext | encrypts with L, the number of letters on the rod (belongs to [1,[)
        `shift` | text <-> shift(N) ciphertext | shift ordinals with N (belongs to [1,255])
        `sms` | text <-> phone keystrokes | also called T9 code ; uses "`-`" as a separator for encoding, "`-`" or "`_`" or whitespace for decoding
        `southpark` | text <-> Kenny's language | converts letters to Kenny's language from Southpark (whitespace is also handled)
        `tomtom` | text <-> tom-tom encoded text | similar to `morse`, using slashes and backslashes
        `url` | text <-> URL encoded text | aka URL encoding
        `xor` | text <-> XOR(N) ciphertext | XOR with a single byte (N belongs to [1,255])
        `whitespace` | text <-> whitespaces and tabs | replaces bits with whitespaces and tabs
        
        A few variants are also implemented.
        
        **Codec** | **Conversions** | **Comment**
        :---: | :---: | ---
        `baudot-spaced` | text <-> Baudot code groups of bits | groups of 5 bits are whitespace-separated
        `baudot-tape` | text <-> Baudot code tape | outputs a string that looks like a perforated tape
        `bcd-extended0` | text <-> BCD-extended text | encodes characters from their (zero-left-padded) ordinals using prefix bits `0000`
        `bcd-extended1` | text <-> BCD-extended text | encodes characters from their (zero-left-padded) ordinals using prefix bits `1111`
        `manchester-inverted` | text <-> manchester encoded text | XORes each bit of the input with `10`
        `octal-spaced` | text <-> octal digits (whitespace-separated) | dummy octal conversion
        `ordinal-spaced` | text <-> ordinal digits (whitespace-separated) | dummy character ordinals conversion
        `southpark-icase` | text <-> Kenny's language | same as `southpark` but case insensitive
        `whitespace_after_before` | text <-> lines of whitespaces[letter]whitespaces | encodes characters as new characters with whitespaces before and after according to an equation described in the codec name (e.g. "`whitespace+2*after-3*before`")
        
        
Keywords: python,development,programming,codecs,encodings
Platform: UNKNOWN
Classifier: Development Status :: 5 - Production/Stable
Classifier: Environment :: Console
Classifier: Intended Audience :: Developers
Classifier: License :: OSI Approved :: GNU General Public License v3 (GPLv3)
Classifier: Programming Language :: Python :: 2
Classifier: Programming Language :: Python :: 2.7
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: Python :: 3.6
Classifier: Programming Language :: Python :: 3.7
Classifier: Programming Language :: Python :: 3.8
Classifier: Programming Language :: Python :: 3.9
Classifier: Topic :: Software Development :: Libraries :: Python Modules
Requires-Python: !=3.0.*,!=3.1.*,!=3.2.*,!=3.3.*,!=3.4.*,!=3.5.*,<4,>=2.7
Description-Content-Type: text/markdown
