Available genetic codes¶
from cogent3 import available_codes
available_codes()
| Code ID | Name |
|---|---|
| 1 | Standard |
| 2 | Vertebrate Mitochondrial |
| 3 | Yeast Mitochondrial |
| 4 | Mold Mitochondrial; Protozoan Mitochondrial; Coelenterate Mitochondrial; Mycoplasma; Spiroplasma |
| 5 | Invertebrate Mitochondrial |
| 6 | Ciliate Nuclear; Dasycladacean Nuclear; Hexamita Nuclear |
| 9 | Echinoderm Mitochondrial; Flatworm Mitochondrial |
| 10 | Euplotid Nuclear |
| 11 | Bacterial, Archaeal and Plant Plastid |
| 12 | Alternative Yeast Nuclear |
| 13 | Ascidian Mitochondrial |
| 14 | Alternative Flatworm Mitochondrial |
| 15 | Blepharisma Macronuclear |
| 16 | Chlorophycean Mitochondrial |
| 21 | Trematode Mitochondrial |
| 22 | Scenedesmus obliquus Mitochondrial |
| 23 | Thraustochytrium Mitochondrial |
| 24 | Rhabdopleuridae Mitochondrial |
| 25 | Candidate Division SR1 and Gracilibacteria |
| 26 | Pachysolen tannophilus Nuclear |
| 27 | Karyorelict Nuclear |
| 28 | Condylostoma Nuclear |
| 29 | Mesodinium Nuclear |
| 30 | Peritrich Nuclear |
| 31 | Blastocrithidia Nuclear |
| 32 | Balanophoraceae Plastid |
| 33 | Cephalodiscidae Mitochondrial |
27 rows x 2 columns
In cases where a cogent3 object method has a gc argument, you can just use the number under “Code ID” column.
For example:
from cogent3 import load_aligned_seqs
nt_seqs = load_aligned_seqs("data/brca1-bats.fasta", moltype="dna")
nt_seqs[:21]
| 0 | |
| DogFaced | TGTGGCACAAATACTCATGCC |
| FlyingFox | ............G........ |
| FreeTaile | .........G........... |
| LittleBro | .........G........... |
| TombBat | ..........G.......... |
5 x 21 dna alignment
We specify the genetic code, and that codons that are incomplete as they contain a gap, are converted to ?.
aa_seqs = nt_seqs.get_translation(gc=1, incomplete_ok=True)
aa_seqs[:20]
| 0 | |
| DogFaced | CGTNTHANSLQHENSSLLYT |
| FlyingFox | ....A..S......-..... |
| FreeTaile | ...D...S..........L. |
| LittleBro | ...D...S..........L. |
| TombBat | ...S...S.V........L. |
5 x 20 protein alignment
Getting a genetic code with get_code()¶
This function can be used directly to get a genetic code. We will get the code with ID 4.
from cogent3 import get_code
gc = get_code(4)
gc
| aa | IUPAC code | codons |
|---|---|---|
| Alanine | A | GCT,GCC,GCA,GCG |
| Cysteine | C | TGT,TGC |
| Aspartic Acid | D | GAT,GAC |
| Glutamic Acid | E | GAA,GAG |
| Phenylalanine | F | TTT,TTC |
| Glycine | G | GGT,GGC,GGA,GGG |
| Histidine | H | CAT,CAC |
| Isoleucine | I | ATT,ATC,ATA |
| Lysine | K | AAA,AAG |
| Leucine | L | TTA,TTG,CTT,CTC,CTA,CTG |
| Methionine | M | ATG |
| Asparagine | N | AAT,AAC |
| Proline | P | CCT,CCC,CCA,CCG |
| Glutamine | Q | CAA,CAG |
| Arginine | R | CGT,CGC,CGA,CGG,AGA,AGG |
| Serine | S | TCT,TCC,TCA,TCG,AGT,AGC |
| Threonine | T | ACT,ACC,ACA,ACG |
| Valine | V | GTT,GTC,GTA,GTG |
| Tryptophan | W | TGA,TGG |
| Tyrosine | Y | TAT,TAC |
| STOP | * | TAA,TAG |