Metadata-Version: 2.1
Name: olha
Version: 0.1.1
Summary: Fast generation of TCR/BCR sequences with olga
Home-page: UNKNOWN
Author: Thomas Dupic
Author-email: dupic.thomas@gmail.com
License: MIT
Description: # olha
        A package to generate TCR/BCR sequences fast, based on [olga](https://github.com/statbiophys/OLGA). Use the same syntax as olga but is up to 20x faster and can optionally generate non-functional sequences and include point-mutation "sequencing" errors. It also allows for selection of specific V/J pairs for generation. 
        
        Written in C++, interface with python3 via pybind11.
        
        ## Installation
        
        ```sh
        pip install olha
        ```
        
        
        ## Example
        
        ```py
        import olga
        import olga.sequence_generation
        import olga.load_model
        import olha
        
        ## olga model loading
        params_file_name = f'{olga.__path__[0]}/default_models/human_T_beta/model_params.txt'
        marginals_file_name = f'{olga.__path__[0]}/default_models/human_T_beta/model_marginals.txt'
        V_anchor_pos_file =f'{olga.__path__[0]}/default_models/human_T_beta/V_gene_CDR3_anchors.csv'
        J_anchor_pos_file = f'{olga.__path__[0]}/default_models/human_T_beta/J_gene_CDR3_anchors.csv'
        
        genomic_data = olga.load_model.GenomicDataVDJ()
        genomic_data.load_igor_genomic_data(params_file_name, V_anchor_pos_file, J_anchor_pos_file)
        generative_model = olga.load_model.GenerativeModelVDJ()
        generative_model.load_and_process_igor_model(marginals_file_name)
        
        # sequence generation
        olha_gen = olha.SequenceGeneration(genomic_data, generative_model, error_rate=0.1)
        olha_gen.gen_rnd_prod_CDR3()
        # ('TGCGCCAGCAGCTCCATGGACGGCTCCGAAAAACTGTTTTTT', 'CASSSMDGSEKLFF', 49, 3)
        ```
        
        ## Comparison
        ```py
        import timeit
        olha_gen = olha.SequenceGeneration(genomic_data, generative_model, error_rate=0.1)
        olga_gen = olga.sequence_generation.SequenceGenerationVDJ(generative_model, genomic_data)
        
        timeit.timeit(olha_gen.gen_rnd_prod_CDR3) # 3.31 μs
        timeit.timeit(olga_gen.gen_rnd_prod_CDR3) # 103 μs
        ```
        
Platform: UNKNOWN
Classifier: Development Status :: 3 - Alpha
Classifier: Intended Audience :: Developers
Classifier: Intended Audience :: Healthcare Industry
Classifier: Intended Audience :: Science/Research
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Classifier: Topic :: Scientific/Engineering :: Physics
Classifier: Topic :: Scientific/Engineering :: Medical Science Apps.
Classifier: Natural Language :: English
Classifier: Programming Language :: Python :: 3.6
Description-Content-Type: text/markdown
