Readme

# Pygor3

Pygor3 is a python3 framework to analyze, vizualize, generate and infer V(D)J recombination models using the [IGoR](https://github.com/statbiophys/IGoR) software. Pygor3 provides a python interface to execute and encapsulate IGoR’s input/outputs by using a sqlite3 database that contains input sequences, alignments, model parameters, conditional probabilities of the model Bayes network, best scenarios and generation probabilities in a single db file. Pygor3 also has command line utilities to import/export IGoR generated files to [AIRR standard format](https://docs.airr-community.org/en/latest/index.html).

## Installation 1. First install IGoR in your sytem [IGoR](https://github.com/statbiophys/IGoR) if you don’t have it already. Pygor will use default IGoR’s path to execute it’s commands.

2. (Optional) Install [conda](https://docs.conda.io/en/latest/) or [anaconda](https://www.anaconda.com/) and create (or use ) a virtual environment.

```console

$ conda create –name statbiophys python=3.7 $ conda activate statbiophys

```

  1. Use the package manager [pip](https://pip.pypa.io/en/stable/)

    `console (statbiophys) $ pip install pygor3 `

### Github installation For the most version of pygor (from Github)

`console (statbiophys) $ git clone https://github.com/statbiophys/pygor3.git (statbiophys) $ cd pygor3 (statbiophys) $ pip install -e . `

## Command Line Usage

### Quickstart

#### Get demo sample data Download a copy of demo sequences in current directory

`console $ pygor demo-get-data -------------------------------- Copy data from :  /home/olivares/GitHub/statbiophys/pygor3/pygor3/demo to:  /home/olivares/testing_pygor/demo ` This command creates a directory demo with the following structure, with sequences to infer and evaluate a new model.

```console demo/ └── data

└── IgL

├── IgL_seqs_memory_Functional.txt ├── IgL_seqs_memory_Nofunctional.txt ├── IgL_seqs_naive_Functional.txt └── IgL_seqs_naive_Nofunctional.txt

```

#### New Model Now to create a model from scratch, donwload gene templates and anchors from IMGT website [IMGT](http://www.imgt.org/) A list of available species to download from IMGT can be queried with imgt-get-genomes command and option –info.

```console $ pygor imgt-get-genomes –info ——————————– http://www.imgt.org Downloading data from … List of IMGT available species:

Gallus+gallus Cercocebus+atys Mustela+putorius+furo Macaca+nemestrina Vicugna+pacos Mus+cookii Bos+taurus Canis+lupus+familiaris Ornithorhynchus+anatinus Macaca+mulatta Rattus+rattus Mus+minutoides Danio+rerio Oncorhynchus+mykiss Tursiops+truncatus Felis+catus Homo+sapiens Salmo+salar Macaca+fascicularis Mus+musculus Mus+saxicola Capra+hircus Sus+scrofa Mus+pahari Ovis+aries Equus+caballus Camelus+dromedarius Oryctolagus+cuniculus Papio+anubis+anubis Mus+spretus Rattus+norvegicus For more details access: http://www.imgt.org/download/GENE-DB/IMGTGENEDB-GeneList ```

  1. Download genomic templates using VJ or VDJ corresponding to the type of chain.

    ```console $ pygor imgt-get-genomes –imgt-species Homo+sapiens –imgt-chain IGL -t VJ ——————————– http://www.imgt.org get_ref_genome Homo+sapiens IGLV http://www.imgt.org/genedb/GENElect?query=7.2+IGLV&species=Homo+sapiens http://www.imgt.org/genedb/GENElect?query=7.2+IGLV&species=Homo+sapiens Homo+sapiens IGLJ http://www.imgt.org/genedb/GENElect?query=7.2+IGLJ&species=Homo+sapiens http://www.imgt.org/genedb/GENElect?query=7.2+IGLJ&species=Homo+sapiens http://www.imgt.org/genedb/GENElect?query=8.1+IGLV&species=Homo+sapiens&IMGTlabel=2nd-CYS No anchor is found for : AC279423|IGLV(I)-11-1*01|Homo sapiens|P|V-REGION|22452..22620|169 nt|1| | | | |169+0=169|partial in 5'| | No anchor is found for : D87007|IGLV(I)-20*01|Homo sapiens|P|V-REGION|15573..15858|286 nt|1| | | | |286+0=286| | | No anchor is found for : AC279208|IGLV(I)-20*02|Homo sapiens|P|V-REGION|19943..20228|286 nt|1| | | | |286+0=286| | |

    …

    Number of features: 0 Seq(‘TGCTGTGTTCGGAGGAGGCACCCAGCTGACCGTCCTCG’) ID: D87017|IGLJ7*02|Homo Name: D87017|IGLJ7*02|Homo Description: D87017|IGLJ7*02|Homo sapiens|F|J-REGION|18513..18550|38 nt|2| | | | |38+0=38| | | Number of features: 0 Seq(‘TGCTGTGTTCGGAGGAGGCACCCAGCTGACCGCCCTCG’) ———————- Genomic VJ templates in files: models/Homo+sapiens/IGL/ref_genome/genomicVs__imgt.fasta models/Homo+sapiens/IGL/ref_genome/genomicJs__imgt.fasta

    ```

    This command creates a directory models with the following structure

    ``` models/ └── Homo+sapiens

    └── TRB

    ├── models └── ref_genome

    ├── genomicDs.fasta ├── genomicDs__imgt.fasta ├── genomicDs__imgt.fasta_short ├── genomicJs.fasta ├── genomicJs__imgt.fasta ├── genomicJs__imgt.fasta_short ├── genomicJs__imgt.fasta_trim ├── genomicVs.fasta ├── genomicVs__imgt.fasta ├── genomicVs__imgt.fasta_short ├── genomicVs__imgt.fasta_trim ├── J_gene_CDR3_anchors.csv ├── J_gene_CDR3_anchors__imgt.csv ├── J_gene_CDR3_anchors__imgt.csv_short ├── V_gene_CDR3_anchors.csv ├── V_gene_CDR3_anchors__imgt.csv └── V_gene_CDR3_anchors__imgt.csv_short

    ```

    — Important Note It is important to review carefully your downloaded genes templates. Pygor automatically rename from long IMGT descriptions to a short ones. For instance

    D86996|IGLV(I)-56*01|Homo sapiens|P|V-REGION|12276..12571|296 nt|1| | | | |296+0=296| | |

    D86996|IGLV(I)-56*01|Homo sapiens|P|V-REGION|12576..12876|301 nt|1| | | | |301+0=301| | |

    Are renamed as :

    IGLV(I)-56*01

    IGLV(I)-56*01

    For these cases, is important to rename it or remove it manually, before create a new model. For simplicity in this demo we remove the second IGLV(I)-56*01

    —

3. Create a new initial default model, with uniform distribution for the conditional probabilities of Bayes network (“model_marginals.txt” file). Notice that in IGoR this file is called marginals, but it is not the marginal probability of a recombination event.

`console $ pygor model-create -M models/Homo+sapiens/IGL/ -t VJ -------------------------------- No D genes were found. [Errno 2] No such file or directory: 'models/Homo+sapiens/IGL//ref_genome//genomicDs.fasta' No D genes were found. [Errno 2] No such file or directory: 'models/Homo+sapiens/IGL//ref_genome//genomicDs.fasta' igortask.igor_model_dir_path:  models/Homo+sapiens/IGL/ Writing model parms in file  models/Homo+sapiens/IGL//models/model_parms.txt Writing model marginals in file  models/Homo+sapiens/IGL//models/model_marginals.txt `

Initial models with uniform parameters model files will be created in files model_parms.txt and model_marginals.txt at directory path

```console models/ └── Homo+sapiens

└── IGL

├── models │   ├── model_marginals.txt │   └── model_parms.txt └── ref_genome

├── genomicJs.fasta ├── genomicJs__imgt.fasta ├── genomicJs__imgt.fasta_short ├── genomicJs__imgt.fasta_trim ├── genomicVs.fasta ├── genomicVs__imgt.fasta ├── genomicVs__imgt.fasta_short ├── genomicVs__imgt.fasta_trim ├── J_gene_CDR3_anchors.csv ├── J_gene_CDR3_anchors__imgt.csv ├── J_gene_CDR3_anchors__imgt.csv_short ├── V_gene_CDR3_anchors.csv ├── V_gene_CDR3_anchors__imgt.csv └── V_gene_CDR3_anchors__imgt.csv_short

```

At this point you can use a set of non-productive sequence to infer a model within IGoR directly or by using pygor command (the simpler option).

```console $ pygor igor-infer -M models/Homo+sapiens/IGL/ -i data/IgL/IgL_seqs_naive_Nofunctional.txt -o new_IgL_naive ——————————– ===== Running inference ===== … WARNING: write_model_parms path [Errno 2] No such file or directory: ‘’ Writing model parms in file new_IgL_naive_parms.txt WARNING: IgorModel_Marginals.write_model_marginals path [Errno 2] No such file or directory: ‘’ Writing model marginals in file new_IgL_naive_marginals.txt Database file : new_IgL_naive

```

This will output the following files

`console new_IgL_naive.db new_IgL_naive_BN.pdf new_IgL_naive_PM.pdf new_IgL_naive_marginals.txt new_IgL_naive_parms.txt `

where new_hs_trb.db is a database with the encapsulated information about the new model and the date used by IGoR to infer it, new_IgL_naive_BN.pdf is a plot of the Bayesian network(BN) of inferred model, new_IgL_naive_PM.pdf are plots of the real marginals of events in BN, and finally the new_IgL_naive_parms.txt and new_IgL_naive_marginals.txt the inferred model in IGoR’s format.

#### Model Plots A model can be plotted from a database file, model directory or by passing the model_parms.txt and model_marginals.txt

```

$ pygor model-plot -M models/Homo+sapiens/IGL/ -o IgL_plot

or

$ pygor model-plot -D new_IgL_naive.db -o IgL_plot ``` This will output two pdf files with the Marginal Probabilities and Conditional probabilities of events

![](BayesNetwork.png) ![](GeneChoice_MP.png) ![](GeneChoice_CP.png)

#### Database files The .db files can contain all the information in IGoR’s standard files in a single sqlite database file, and can be examinated with any sqlite client, like sqlite3 or sqlitebrowser

```console $ sqlite3 new_IgL_naive.db SQLite version 3.33.0 2020-08-14 13:23:32 Enter “.help” for usage hints. sqlite> .tables IgorDAlignments IgorIndexedSeq IgorMM_vj_ins IgorDGeneTemplate IgorJAlignments IgorMP_Edges IgorER_j_5_del IgorJGeneCDR3Anchors IgorMP_ErrorRate IgorER_j_choice IgorJGeneTemplate IgorMP_Event_list IgorER_v_3_del IgorMM_j_5_del IgorVAlignments IgorER_v_choice IgorMM_j_choice IgorVGeneCDR3Anchors IgorER_vj_dinucl IgorMM_v_3_del IgorVGeneTemplate IgorER_vj_ins IgorMM_v_choice IgorIndexedCDR3 IgorMM_vj_dinucl

```

Pygor has its own methods to maniputate data a database file. For instance, db-ls list the contents of the database and the number of records

```console $ pygor db-ls -D new_IgL_naive.db ——————————– === Sequences tables igor-reads: IgorIndexedSeq : 24985 === Genomes References tables igor-genomes: IgorVGeneTemplate : 151 IgorJGeneTemplate : 10 IgorDGeneTemplate : 0 IgorVGeneCDR3Anchors : 111 IgorJGeneCDR3Anchors : 10 === Alignments tables igor-alignments: IgorIndexedCDR3 : 24985 IgorVAlignments : 846743 IgorJAlignments : 257400 IgorDAlignments : 0 === Model tables igor-model: IgorMP_Event_list : 6 IgorMP_Edges : 3 IgorMP_ErrorRate : 1 IgorER_v_choice : 151 IgorER_j_choice : 10 IgorER_v_3_del : 21 IgorER_j_5_del : 21 IgorER_vj_ins : 41 IgorER_vj_dinucl : 4 IgorMM_v_choice : 151 IgorMM_j_choice : 1510 IgorMM_v_3_del : 3171 IgorMM_j_5_del : 210 IgorMM_vj_ins : 41 IgorMM_vj_dinucl : 16 === Output tables igor-pgen and igor-scenarios:

```

In a similar way the commands db-rm, db-cp, db-import and db-export can be used to manipulate database files.

```console $ pygor db-cp -D new_IgL_naive.db -o new_IgL_naive_mdl.db –igor-genomes –igor-model ——————————– **** Tables in source database : new_IgL_naive.db === Sequences tables igor-reads: IgorIndexedSeq : 24985 === Genomes References tables igor-genomes: IgorVGeneTemplate : 151 IgorJGeneTemplate : 10 IgorDGeneTemplate : 0 IgorVGeneCDR3Anchors : 111 IgorJGeneCDR3Anchors : 10 === Alignments tables igor-alignments: IgorIndexedCDR3 : 24985 IgorVAlignments : 846743 IgorJAlignments : 257400 IgorDAlignments : 0 === Model tables igor-model: IgorMP_Event_list : 6 IgorMP_Edges : 3 IgorMP_ErrorRate : 1 IgorER_v_choice : 151 IgorER_j_choice : 10 IgorER_v_3_del : 21 IgorER_j_5_del : 21 IgorER_vj_ins : 41 IgorER_vj_dinucl : 4 IgorMM_v_choice : 151 IgorMM_j_choice : 1510 IgorMM_v_3_del : 3171 IgorMM_j_5_del : 210 IgorMM_vj_ins : 41 IgorMM_vj_dinucl : 16 === Output tables igor-pgen and igor-scenarios: **** Tables in destiny database: new_IgL_naive_mdl.db === Sequences tables igor-reads: === Genomes References tables igor-genomes: IgorVGeneTemplate : 151 IgorJGeneTemplate : 10 IgorDGeneTemplate : 0 IgorVGeneCDR3Anchors : 111 IgorJGeneCDR3Anchors : 10 === Alignments tables igor-alignments: === Model tables igor-model: IgorMP_Event_list : 6 IgorMP_Edges : 3 IgorMP_ErrorRate : 1 IgorER_v_choice : 151 IgorER_j_choice : 10 IgorER_v_3_del : 21 IgorER_j_5_del : 21 IgorER_vj_ins : 41 IgorER_vj_dinucl : 4 IgorMM_v_choice : 151 IgorMM_j_choice : 1510 IgorMM_v_3_del : 3171 IgorMM_j_5_del : 210 IgorMM_vj_ins : 41 IgorMM_vj_dinucl : 16 === Output tables igor-pgen and igor-scenarios:

```

#### Model evaluation Once we have an inferred model we can evaluate the probability of a particular sequence to be generated (pgen) and get the most probable scenarios for the recombination of input sequences or generate synthetic sequences. We can evaluate sequences using the following files: model_parms.txt, model_marginals.txt, genomicXs.fasta, and X_gene_CDR3_anchors.csv or we can just use a database file with all this information like above. For instance the “new_IgL_naive_mdl.db” file, in the example above, contains only the model and genomes information, which is necessary for the alignment and evaluation for IGoR.

`console $ pygor igor-evaluate -D new_IgL_naive_mdl.db -i data/IgL/IgL_seqs_naive_Functional_small.txt  -o IgL_naive_evaluated `

An tsv airr standard format is created with the rearragement.

` sequence_id     sequence        rev_comp        productive      v_call  d_call  j_call  sequence_alignment      germline_alignment      junction        junction_aa     v_cigar d_cigar j_cigar v_score v_identity      v_support       v_sequence_start        v_sequence_end  v_germline_start        v_germline_end  v_alignment_start       v_alignment_end d_score d_identity      d_support       d_sequence_start        d_sequence_end  d_germline_start        d_germline_end  d_alignment_start       d_alignment_end j_score j_identity      j_support       j_sequence_start        j_sequence_end  j_germline_start        j_germline_end  j_alignment_start       j_alignment_end sequence_aa     vj_in_frame     stop_codon      complete_vdj    locus   sequence_alignment_aa   n1_length       np1     np1_aa  np1_length      n2_length       np2     np2_aa  np2_length      p3v_length      p5d_length      p3d_length      p5j_length      scenario_rank   scenario_proba_cond_seq pgen    quality quality_alignment 0       CAGTCTCCCAGGTACAAAGTCACAAAGAGGGGACAGGATGTAACTCTCAGGTGTGATCCAATTTCGAGTCATGCAACCCTTTATTGGTATCAACAGGCCCTGGGGCAGGGCCCAGAGTTTCTGACTTACTTCAATTATGAAGCTCAACCAGACAAATCAGGGCTGCCCAGTGATCGGTTCTCTGCAGAGAGGCCTGAGGGATCCATCTCCACTCTGACGATTCAGCGCACAGAGCAGCGGGACTCAGCCATGTATCGCTGTGCTAGCAGCATTCCTCGGGCTGTCAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCG       F               TRBV7-7*01      TRBD2*02        TRBJ2-3*01      GGTGCTGGAGTCTCCCAGTCTCCCAGGTACAAAGTCACAAAGAGGGGACAGGATGTAACTCTCAGGTGTGATCCAATTTCGAGTCATGCAACCCTTTATTGGTATCAACAGGCCCTGGGGCAGGGCCCAGAGTTTCTGACTTACTTCAATTATGAAGCTCAACCAGACAAATCAGGGCTGCCCAGTGATCGGTTCTCTGCAGAGAGGCCTGAGGGATCCATCTCCACTCTGACGATTCAGCGCACAGAGCAGCGGGACTCAGCCATGTATCGCTGTGCCAGCAGCATTCCTCGGGCTGTCAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCG                TGTGCTAGCAGCATTCCTCGGGCTGTCAGATACGCAGTATTTT             285M    4M      45M     1425                    2       285     16      283                     20                      290     292     10      13                      225                     7       50      6       50              6ATTCCT         6       4       CTGT            4       0       0       0       0       1       0.02729091.34834e-19 0       CAGTCTCCCAGGTACAAAGTCACAAAGAGGGGACAGGATGTAACTCTCAGGTGTGATCCAATTTCGAGTCATGCAACCCTTTATTGGTATCAACAGGCCCTGGGGCAGGGCCCAGAGTTTCTGACTTACTTCAATTATGAAGCTCAACCAGACAAATCAGGGCTGCCCAGTGATCGGTTCTCTGCAGAGAGGCCTGAGGGATCCATCTCCACTCTGACGATTCAGCGCACAGAGCAGCGGGACTCAGCCATGTATCGCTGTGCTAGCAGCATTCCTCGGGCTGTCAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCG       F               TRBV7-7*01      TRBD2*01        TRBJ2-3*01      GGTGCTGGAGTCTCCCAGTCTCCCAGGTACAAAGTCACAAAGAGGGGACAGGATGTAACTCTCAGGTGTGATCCAATTTCGAGTCATGCAACCCTTTATTGGTATCAACAGGCCCTGGGGCAGGGCCCAGAGTTTCTGACTTACTTCAATTATGAAGCTCAACCAGACAAATCAGGGCTGCCCAGTGATCGGTTCTCTGCAGAGAGGCCTGAGGGATCCATCTCCACTCTGACGATTCAGCGCACAGAGCAGCGGGACTCAGCCATGTATCGCTGTGCCAGCAGCATTCCTCGGGCTGTCAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCG                TGTGCTAGCAGCATTCCTCGGGCTGTCAGATACGCAGTATTTT             285M    4M      45M     1425                    2       285     16      283                     20                      290     292     10      13                      225                     7       50      6       50              6ATTCCT         6       4       CTGT            4       0       0       0       0       2       0.02729091.34834e-19 ... `

## Documentation

All the command line interface commands can be used in a python environment, like jupyter notebook, by exporting the pygor3 package

`python import pygor3 as p3 mdl = p3.IgorModel(model_parms_file="model_parms.txt", model_marginals_file="model_marginals.txt") `

For further details checkout the [documentation]() and notebooks directory.