Metadata-Version: 2.1
Name: headloop
Version: 1.0.11
Summary: Package for designing headloop primers to use in headloop suppression PCR to suppress amplification of a known haplotype.
Home-page: https://github.com/GTPowell21/Headloop
Author: Gareth T. Powell
Author-email: g.powell@ucl.ac.uk
License: GPLv3
Description: # Headloop
        Package for designing headloop primers to use in headloop suppression PCR to 
        suppress amplification of a known haplotype.
        Copyright (C) July 2020, Gareth T. Powell
        
        ## License
        This program is free software: you can redistribute it and/or modify
        it under the terms of the GNU General Public License as published by
        the Free Software Foundation, either version 3 of the License, or
        (at your option) any later version.
        
        This program is distributed in the hope that it will be useful,
        but WITHOUT ANY WARRANTY; without even the implied warranty of
        MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
        GNU General Public License for more details.
        
        You should have received a copy of the GNU General Public License
        along with this program.  If not, see <https://www.gnu.org/licenses/>.
        
        ## Description
        Function designs tags from guide sequence provided by the user, with frameshifting 
        to minimise Tm differences between the tags and the PCR primers, then adds the 'best' 
        tags to the correct PCR primer provided by the user, depending upon strand orientation 
        of the guide sequence relative to the PCR primers e.g. if the guide sequence in on the
        same strand as the sense primer, a reverse complement tag is added to the sense 
        primer and an offset tag is added to the antisense primer.
        
        For further details of headloop suppression PCR, see the paper at eLife:
            
            Kroll, F., Powell, G.T. et al (2021) eLife 10:e59683, doi: 10.7554/eLife.59683
            https://doi.org/10.7554/eLife.59683
        
        ## Installation
        
            pip install headloop
        
        This package uses 'melting' from Erik Clarke [https://github.com/eclarke/melt] to 
        calculate Tm of primers and headloop tags, and Seq & SeqRecord from Biopython 
        [https://biopython.org/wiki/Seq] for reverse complementation and object input/output.
        
        ## Usage
        To use this package, the user needs to provide four variables:
            
            sense_oligo     #string containing the sense primer
            antisense_oligo #string containing the antisense primer
            guide_context   #string containing guide sequence and >= 15 bp forward context
            orientation     #is the guide in the same strand as the 'sense' primer or 'antisense' primer?
        
        Example (tbx16_AA):
        
            from headloop.designer import design
            
            design('CTGGTCCAGTGCGTTATTGG', 'AGCCAAATGCTTCTTGCTCTTTT', 
                   'CTACAGGACGTACCTGCACCCGGATTCACCAGCGCCCG', 'antisense')
            
        Returns:
            Two primers as SeqRecord objects, with comments on Tm matching in the description
            
            CCTGCACCCGGATTCACCAGCTGGTCCAGTGCGTTATTGG
            WARNING: Could not optimise sense headloop tag (Tm difference > 3°C) 
            
            GGTGCAGGTACGTCCTGTAGAGCCAAATGCTTCTTGCTCTTTT
            Tm difference < 3°C
            
            (Gives a warning flag if the Tm difference between the headloop tag and the 
             base primer is calculated to be > 3C)
        
Platform: UNKNOWN
Classifier: Programming Language :: Python :: 3
Classifier: License :: OSI Approved :: GNU General Public License v3 (GPLv3)
Classifier: Operating System :: OS Independent
Classifier: Intended Audience :: Science/Research
Requires-Python: >=3.6
Description-Content-Type: text/markdown
