Source code for dandelion.preprocessing._preprocessing

#!/usr/bin/env python
# @Author: kt16
# @Date:   2020-05-12 17:56:02
# @Last Modified by:   Kelvin
# @Last Modified time: 2020-12-30 01:48:33

import sys
import os
import pandas as pd
from subprocess import run
from tqdm import tqdm
import multiprocessing
from multiprocessing import Pool
from joblib import Parallel, delayed
from collections import OrderedDict
from time import sleep
from ..utilities._utilities import *
from .external._preprocessing import assigngenes_igblast, makedb_igblast, parsedb_heavy, parsedb_light, tigger_genotype, creategermlines
from plotnine import ggplot, geom_bar, geom_col, ggtitle, scale_fill_manual, coord_flip, options, element_blank, aes, xlab, ylab, facet_wrap, facet_grid, theme_classic, theme, annotate, theme_bw, geom_histogram, geom_vline
from changeo.Gene import buildGermline
from changeo.IO import countDbFile, getDbFields, getFormatOperators, readGermlines, checkFields
from changeo.Receptor import AIRRSchema, ChangeoSchema, Receptor, ReceptorData
import re
import functools
try:
    from scanpy import logging as logg
except ImportError:
    pass
import numpy as np
from Bio import Align

[docs]def format_fasta(fasta, prefix = None, suffix = None, sep = None, remove_trailing_hyphen_number = True, outdir = None): """ Adds prefix to the headers/contig ids in cellranger fasta and annotation file. Parameters ---------- fasta : str path to fasta file. prefix : str, optional prefix to append to the headers/contig ids. suffix : str, optional suffix to append to the headers/contig ids. sep : str, optional separator after prefix or before suffix to append to the headers/contig ids. remove_trailing_hyphen_number : bool whether or not to remove the trailing hyphen number e.g. '-1' from the cell/contig barcodes. outdir : str, optional path to output location. None defaults to 'dandelion/data'. Returns ------- Formatted fasta file with new headers containing prefix """ filePath = None if os.path.isfile(str(fasta)) and str(fasta).endswith(".fasta"): filePath = fasta elif os.path.isdir(str(fasta)): files = os.listdir(fasta) for file in files: if os.path.isfile(fasta.rstrip('/') + '/' + os.path.basename(file)) and str(file).endswith(".fasta"): filePath = fasta + '/' + os.path.basename(file) if filePath is None: raise OSError('Path to fasta file is unknown. Please specify path to fasta file or folder containing fasta file. Starting folder should only contain 1 fasta file.') fh = open(filePath, 'r') seqs = {} if sep is None: separator = '_' else: separator = str(sep) for header, sequence in fasta_iterator(fh): if prefix is None and suffix is None: seqs[header] = sequence elif prefix is not None: if suffix is not None: if remove_trailing_hyphen_number: newheader = str(prefix)+separator+str(header).split('_contig')[0].split('-')[0]+separator+str(suffix)+'_contig'+str(header).split('_contig')[1] else: newheader = str(prefix)+separator+str(header).split('_contig')[0]+separator+str(suffix)+'_contig'+str(header).split('_contig')[1] else: if remove_trailing_hyphen_number: newheader = str(prefix)+separator+str(header).split('_contig')[0].split('-')[0]+'_contig'+str(header).split('_contig')[1] else: newheader = str(prefix)+separator+str(header) seqs[newheader] = sequence else: if suffix is not None: if remove_trailing_hyphen_number: newheader = str(header).split('_contig')[0].split('-')[0]+separator+str(suffix)+'_contig'+str(header).split('_contig')[1] else: newheader = str(header)+separator+str(suffix) else: newheader = str(header) seqs[newheader] = sequence fh.close() if os.path.isfile(filePath): basedir = os.path.dirname(filePath) elif os.path.isdir(filePath): basedir = os.path.dirname(filePath) else: basedir = os.getcwd() if outdir is None: out_dir = basedir.rstrip('/')+'/'+'dandelion/data/' else: if not outdir.endswith('/'): out_dir = outdir+'/' if not os.path.exists(out_dir): os.makedirs(out_dir) out_fasta = out_dir + os.path.basename(filePath) fh1 = open(out_fasta, 'w') fh1.close() out = '' for l in seqs: out = '>'+l+'\n'+seqs[l]+'\n' Write_output(out, out_fasta) # format the barcode and contig_id in the corresponding annotation file too anno = basedir+'/'+os.path.basename(filePath).replace('.fasta', '_annotations.csv') data = pd.read_csv(anno, dtype = 'object') if prefix is not None: if suffix is not None: if remove_trailing_hyphen_number: data['contig_id'] = [str(prefix)+separator+str(c).split('_contig')[0].split('-')[0]+separator+str(suffix)+'_contig'+str(c).split('_contig')[1] for c in data['contig_id']] data['barcode'] = [str(prefix)+separator+str(b).split('-')[0]+separator+str(suffix) for b in data['barcode']] else: data['contig_id'] = [str(prefix)+separator+str(c).split('_contig')[0]+separator+str(suffix)+'_contig'+str(c).split('_contig')[1] for c in data['contig_id']] data['barcode'] = [str(prefix)+separator+str(b)+separator+str(suffix) for b in data['barcode']] else: if remove_trailing_hyphen_number: data['contig_id'] = [str(prefix)+separator+str(c).split('_contig')[0].split('-')[0]+'_contig'+str(c).split('_contig')[1] for c in data['contig_id']] data['barcode'] = [str(prefix)+separator+str(b).split('-')[0] for b in data['barcode']] else: data['contig_id'] = [str(prefix)+separator+str(c) for c in data['contig_id']] data['barcode'] = [str(prefix)+separator+str(b) for b in data['barcode']] else: if suffix is not None: if remove_trailing_hyphen_number: data['contig_id'] = [str(c).split('_contig')[0].split('-')[0]+separator+str(suffix)+'_contig'+str(c).split('_contig')[1] for c in data['contig_id']] data['barcode'] = [str(b).split('-')[0]+separator+str(suffix) for b in data['barcode']] else: data['contig_id'] = [str(c).split('_contig')[0]+separator+str(suffix)+'_contig'+str(c).split('_contig')[1] for c in data['contig_id']] data['barcode'] = [str(b)+separator+str(suffix) for b in data['barcode']] else: data['contig_id'] = [str(c) for c in data['contig_id']] data['barcode'] = [str(b) for b in data['barcode']] out_anno = out_dir + os.path.basename(filePath).replace('.fasta', '_annotations.csv') data.to_csv(out_anno, index= False)
[docs]def format_fastas(fastas, prefix = None, suffix = None, sep = None, remove_trailing_hyphen_number = True, outdir = None): """ Adds prefix to the headers/contig ids in cellranger fasta and annotation file. Parameters ---------- fastas : list list or sequence of paths to fasta files. prefix : list, optional list or sequence of prefixes to append to headers/contig ids in each fasta file. suffix : str, optional list or sequence of suffixes to append to headers/contig ids in each fasta file. sep : str, optional separator after prefix or before suffix to append to the headers/contig ids. remove_trailing_hyphen_number : bool whether or not to remove the trailing hyphen number e.g. '-1' from the cell/contig barcodes. outdir : str, optional path to out put location. Default is None, which is 'dandelion/data'. Returns ------- Formatted fasta file with new headers containing prefix """ if type(fastas) is not list: fastas = [fastas] if prefix is not None: if type(prefix) is not list: prefix = [prefix] prefix_dict = dict(zip(fastas, prefix)) if suffix is not None: if type(suffix) is not list: suffix = [suffix] suffix_dict = dict(zip(fastas, suffix)) for fasta in tqdm(fastas, desc = 'Formating fasta(s) '): if prefix is None and suffix is None: format_fasta(fasta, prefix = None, suffix = None, sep = None, remove_trailing_hyphen_number = remove_trailing_hyphen_number, outdir = outdir) elif prefix is not None: if suffix is not None: format_fasta(fasta, prefix = prefix_dict[fasta], suffix = suffix_dict[fasta], sep = sep, remove_trailing_hyphen_number = remove_trailing_hyphen_number, outdir = outdir) else: format_fasta(fasta, prefix = prefix_dict[fasta], suffix = None, sep = sep, remove_trailing_hyphen_number = remove_trailing_hyphen_number, outdir = outdir) else: if suffix is not None: format_fasta(fasta, prefix = None, suffix = suffix_dict[fasta], sep = sep, remove_trailing_hyphen_number = remove_trailing_hyphen_number, outdir = outdir) else: format_fasta(fasta, prefix = None, suffix = None, sep = None, remove_trailing_hyphen_number = remove_trailing_hyphen_number, outdir = outdir)
[docs]def assign_isotype(fasta, fileformat = 'blast', org = 'human', correct_c_call = True, correction_dict = None, plot = True, figsize=(4,4), blastdb = None, allele = False, parallel = True, ncpu = None, verbose = False): """ Annotate contigs with constant region call using blastn Parameters ---------- fasta : str path to fasta file. fileformat : str format of V(D)J file/objects. Default is 'blast'. Also accepts 'changeo' (same behaviour as 'blast') and 'airr'. org : str organism of reference folder. Default is 'human'. correct_c_call : bool whether or not to adjust the c_calls after blast based on provided primers specified in `primer_dict` option. Default is True. correction_dict : dict[dict], optional a nested dictionary contain isotype/c_genes as keys and primer sequences as records to use for correcting annotated c_calls. Defaults to a curated dictionary for human sequences if left as none. plot : bool whether or not to plot reassignment summary metrics. Default is True. figsize : tuple[float, float] size of figure. Default is (4, 4). blastdb : str, optional path to blast database. Defaults to `$BLASTDB` environmental variable. allele : bool whether or not to return allele calls. Default is False. parallel : bool whether or not to use parallelization. Default is True. ncpu : int number of cores to use if parallel is True. Default is all available minus 1. verbose : bool whether or not to print the blast command in terminal. Default is False. Returns ------- V(D)J tsv files with constant genes annotated. """ def _run_blastn(fasta, blastdb, fileformat, org, verbose): env = os.environ.copy() if blastdb is None: try: bdb = env['BLASTDB'] except: raise OSError('Environmental variable BLASTDB must be set. Otherwise, please provide path to blast database') bdb = bdb+org+'/'+org+'_BCR_C.fasta' else: env['BLASTDB'] = blastdb bdb = blastdb cmd = ['blastn', '-db', bdb, '-evalue', '0.001', '-max_target_seqs', '1', '-outfmt', '5', '-query', fasta] blast_out = "{}/tmp/{}.xml".format(os.path.dirname(fasta), os.path.basename(fasta).split('.fasta')[0]+fileformat) if verbose: print('Running command: %s\n' % (' '.join(cmd))) with open(blast_out, 'w') as out: run(cmd, stdout = out, env = env) def _parse_BLAST(fasta, fileformat): ''' Parses BLAST output from output files and writes formatted output to BLAST output summary files ''' def split_blast_file(filename): ''' code adapted from http://stackoverflow.com/questions/19575702/pythonhow-to-split-file-into-chunks-by-the-occurrence-of-the-header-word ''' token = '<Iteration>' chunks = [] current_chunk = [] with open(filename) as fh: for line in fh: line = line.rstrip() if line.startswith(token) and current_chunk: chunks.append(current_chunk[:]) current_chunk = [] if not line.startswith("Total queries"): current_chunk.append(line) chunks.append(current_chunk) return (chunks) def extract_blast_info(line): line = line.split()[0] info = line.split(">")[1] info = info.split("<")[0] return (info) input_file = "{}/tmp/{}.xml".format(os.path.dirname(fasta), os.path.basename(fasta).split('.fasta')[0]+fileformat) output_file = "{}/tmp/{}.blastsummary.txt".format(os.path.dirname(fasta), os.path.basename(fasta).split('.fasta')[0]+fileformat) with open(output_file, 'w') as outfile: outfile.write("------------------\n##{}##\n------------------\n\n#BCR#\n\n".format(fasta)) # Split result file into chunks corresponding to results for each query sequence. if os.path.isfile(input_file): blast_result_chunks = split_blast_file(input_file) for chunk in blast_result_chunks: message = False for line_x in chunk: line_x= line_x.strip() if line_x.startswith("<Iteration_query-def>"): line = line_x.split(">")[1] blast_query_name = line.split("<")[0] elif line_x.startswith("<Hsp_evalue>"): evalue = extract_blast_info(line_x) evalue = format(float(evalue), '.0e') elif line_x.startswith("<Hit_accession>"): C_segment = extract_blast_info(line_x) if "C-REGION" or "CH1" in C_segment: C_segment = C_segment.split("_")[0] elif line_x.startswith("<Hsp_bit-score>"): bit_score = extract_blast_info(line_x) elif line_x.startswith("<Hsp_query-from>"): q_start = extract_blast_info(line_x) elif line_x.startswith("<Hsp_query-to>"): q_end = extract_blast_info(line_x) elif line_x.startswith("<Hsp_hit-from>"): s_start = extract_blast_info(line_x) elif line_x.startswith("<Hsp_hit-to>"): s_end = extract_blast_info(line_x) elif line_x.startswith("<Iteration_query-len>"): query_length = extract_blast_info(line_x) elif line_x.startswith("<Hsp_align-len>"): align_length = extract_blast_info(line_x) elif line_x.startswith("<Hsp_gaps>"): gaps = extract_blast_info(line_x) elif line_x.startswith("<Hsp_identity>"): identity = extract_blast_info(line_x) elif line_x.startswith("<Hsp_qseq>"): c_qseq = extract_blast_info(line_x) elif line_x.startswith("<Hsp_hseq>"): c_hseq = extract_blast_info(line_x) elif line_x.startswith("<Iteration_message>No hits found"): message = True out_string = "##{blast_query_name}##\nNo C segment found\n\n".format( blast_query_name=blast_query_name) outfile.write(out_string) # Create output string when reaching end of BLAST # iteration result (marked by </Iteration>) and write # to BLAST summary file elif line_x.startswith("</Iteration>") and message is not True: identity_pro = float(identity)/int(align_length)*100 identity_pro = format(identity_pro, '.2f') mismatches = int(align_length) - int(identity) #Account for reversed sequences if int(s_start) > int(s_end): blast_query_name = "reversed|" + blast_query_name x, y = int(q_start), int(q_end) q_start = int(query_length) - y + 1 q_end = int(query_length) - x + 1 s_start, s_end = s_end, s_start intro_string = "##{}##\nC segment:\t{}\n\n".format( blast_query_name, C_segment) header_string = ("Segment\tquery_id\tsubject_id\t% identity\talignment length\t" "mismatches\tgap opens\tgaps\tq start\tq end\ts start\ts end\t" "evalue\tbit score\n") out_string = ("C\t{blast_query_name}\t{C_segment}\t{identity_pro}\t{align_length}\t{mismatches}\tNA\t{gaps}\t{q_start}\t{q_end}\t{s_start}\t{s_end}\t{evalue}\t{bit_score}\t{q_seq}\t{h_seq}\n\n").format( blast_query_name=blast_query_name, C_segment=C_segment, identity_pro=identity_pro, align_length=align_length, evalue=evalue, mismatches=mismatches, gaps=gaps, q_start=q_start, q_end=q_end, s_start=s_start, s_end=s_end, bit_score=bit_score, q_seq = c_qseq, h_seq = c_hseq) string_to_write = intro_string + header_string + out_string outfile.write(string_to_write) def _get_C(fasta, fileformat, allele = False, parallel = True, ncpu = None): def _get_C_call(fasta, contig_name, fileformat, allele = False): blast_summary_file = "{}/tmp/{}.blastsummary.txt".format(os.path.dirname(fasta), os.path.basename(fasta).split('.fasta')[0]+fileformat) C_seq,C_germ, C_gene, C_ident, C_eval, C_bitscore, C_qstart, C_qend = None, None, None, None, None, None, None, None with open(blast_summary_file, 'r') as input: for line in input: if line.startswith("C\t{contig_name}".format( contig_name=contig_name)) or line.startswith("C\treversed|{contig_name}".format(contig_name=contig_name)): C_gene = line.split("\t")[2] C_ident = line.split("\t")[3] C_seq = line.split("\t")[14] C_germ = line.split("\t")[15] C_eval = line.split("\t")[12] C_bitscore = line.split("\t")[13] C_qstart = line.split("\t")[8] C_qend = line.split("\t")[9] if "_CH1" or "_C-REGION" in C_gene: C_gene = C_gene.split("_")[0] if not allele: try: C_gene = C_gene.split('*')[0] except: pass C_call, C_identity, C_sequence, C_germline, C_support, C_score, C_start, C_end, = {}, {}, {}, {}, {}, {}, {}, {} C_call[contig_name] = C_gene C_identity[contig_name] = C_ident C_sequence[contig_name] = C_seq C_germline[contig_name] = C_germ C_support[contig_name] = C_eval C_score[contig_name] = C_bitscore C_start[contig_name] = C_qstart C_end[contig_name] = C_qend return(C_sequence, C_germline, C_call, C_identity, C_support, C_score, C_start, C_end) fh = open(fasta, 'r') contigs = [] for header, sequence in fasta_iterator(fh): contigs.append(header) fh.close() if parallel: if ncpu is None: num_cores = multiprocessing.cpu_count()-1 else: num_cores = int(ncpu) results = () results = Parallel(n_jobs=num_cores)(delayed(_get_C_call)(fasta, c, fileformat, allele) for c in tqdm(contigs, desc = 'Retrieving contant region calls, parallelizing with ' + str(num_cores) + ' cpus ')) # transform list of dicts to dict seq, germ, call, ident, support, score, start, end = {}, {}, {}, {}, {}, {}, {}, {} for r in range(0, len(results)): _seq, _germ, _call, _ident, _support, _score, _start, _end = results[r] seq.update(_seq) germ.update(_germ) call.update(_call) ident.update(_ident) support.update(_support) score.update(_score) start.update(_start) end.update(_end) else: seq, germ, call, ident, support, score, start, end = {}, {}, {}, {}, {}, {}, {}, {} for c in tqdm(contigs, desc = 'Retrieving contant region calls '): seq[c], germ[c], call[c], ident[c], support[c], score[c], start[c], end[c] = _get_C_call(fasta, c, fileformat, allele)[c] return(seq, germ, call, ident, support, score, start, end) def _transfer_c(data, c_dict, colname): _data = load_data(data) if colname not in _data.columns: _data = _data.merge(pd.DataFrame.from_dict(c_dict, orient = 'index', columns = [colname]), left_index = True, right_index = True) else: _data[colname] = pd.Series(c_dict) return(_data) def _add_cell(data): _data = load_data(data) _data['cell_id'] = [c.split('_contig')[0] for c in _data['sequence_id']] return(_data) aligner = Align.PairwiseAligner() def two_gene_correction(self, i, dictionary): key1, key2 = dictionary.keys() seq = self.loc[i, 'c_sequence_alignment'].replace('-', '') alignments1 = aligner.align(dictionary[key1], seq) alignments2 = aligner.align(dictionary[key2], seq) score1 = alignments1.score score2 = alignments2.score if score1 == score2: self.at[i, 'c_call'] = str(key1)+','+str(key2) if score1 > score2: self.at[i, 'c_call'] = str(key1) if score1 < score2: self.at[i, 'c_call'] = str(key2) def three_gene_correction(self, i, dictionary): key1, key2, key3 = dictionary.keys() seq = self.loc[i, 'c_sequence_alignment'].replace('-', '') alignments1 = aligner.align(dictionary[key1], seq) alignments2 = aligner.align(dictionary[key2], seq) alignments3 = aligner.align(dictionary[key3], seq) score1 = alignments1.score score2 = alignments2.score score3 = alignments3.score if score1 == score2 == score3: self.at[i, 'c_call'] = str(key1)+','+str(key2)+','+str(key3) elif score1 > score2 and score1 > score3: self.at[i, 'c_call'] = str(key1) elif score2 > score1 and score2 > score3: self.at[i, 'c_call'] = str(key2) elif score3 > score1 and score3 > score2: self.at[i, 'c_call'] = str(key3) elif score1 == score2 and score1 > score3: self.at[i, 'c_call'] = str(key1)+','+str(key2) elif score1 > score2 and score1 == score3: self.at[i, 'c_call'] = str(key1)+','+str(key3) elif score2 > score1 and score2 == score3: self.at[i, 'c_call'] = str(key2)+','+str(key3) def four_gene_correction(self, i, dictionary): key1, key2, key3, key4 = dictionary.keys() seq = self.loc[i, 'c_sequence_alignment'].replace('-', '') alignments1 = aligner.align(dictionary[key1], seq) alignments2 = aligner.align(dictionary[key2], seq) alignments3 = aligner.align(dictionary[key3], seq) alignments4 = aligner.align(dictionary[key4], seq) score1 = alignments1.score score2 = alignments2.score score3 = alignments3.score score4 = alignments4.score if score1 == score2 == score3 == score4: self.at[i, 'c_call'] = str(key1)+','+str(key2)+','+str(key3)+','+str(key4) elif score1 > score2 and score1 > score3 and score1 > score4: self.at[i, 'c_call'] = str(key1) elif score2 > score1 and score2 > score3 and score2 > score4: self.at[i, 'c_call'] = str(key2) elif score3 > score1 and score3 > score2 and score3 > score4: self.at[i, 'c_call'] = str(key3) elif score4 > score1 and score4 > score2 and score4 > score3: self.at[i, 'c_call'] = str(key4) elif score1 == score2 and score1 > score3 and score1 > score4: self.at[i, 'c_call'] = str(key1)+','+str(key2) elif score1 > score2 and score1 == score3 and score1 > score4: self.at[i, 'c_call'] = str(key1)+','+str(key3) elif score1 > score2 and score1 > score3 and score1 == score4: self.at[i, 'c_call'] = str(key1)+','+str(key4) elif score2 == score3 and score2 > score1 and score2 > score4: self.at[i, 'c_call'] = str(key1)+','+str(key3) elif score2 == score4 and score2 > score1 and score2 > score3: self.at[i, 'c_call'] = str(key2)+','+str(key4) elif score3 == score4 and score3 > score1 and score3 > score2: self.at[i, 'c_call'] = str(key3)+','+str(key4) elif score1 == score2 == score3 and score1 > score4: self.at[i, 'c_call'] = str(key1)+','+str(key2)+','+str(key3) elif score1 == score2 == score4 and score1 > score3: self.at[i, 'c_call'] = str(key1)+','+str(key2)+','+str(key4) elif score1 == score3 == score4 and score1 > score2: self.at[i, 'c_call'] = str(key1)+','+str(key3)+','+str(key4) elif score2 == score3 == score4 and score2 > score1: self.at[i, 'c_call'] = str(key2)+','+str(key3)+','+str(key4) def _correct_c_call(data, primers_dict=None): dat = data.copy() if primers_dict is None: primer_dict = { 'IGHG':{ 'IGHG1':'GCCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGC', 'IGHG2':'GCCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCGCCCTGCTCCAGGAGCACCTCCGAGAGCACAGCGGCCCTGGGC', 'IGHG3':'GCTTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCGCCCTGCTCCAGGAGCACCTCTGGGGGCACAGCGGCCCTGGGC', 'IGHG4':'GCTTCCACCAAGGGCCCATCCGTCTTCCCCCTGGCGCCCTGCTCCAGGAGCACCTCCGAGAGCACAGCCGCCCTGGGC'}, 'IGHA':{ 'IGHA1':'GCATCCCCGACCAGCCCCAAGGTCTTCCCGCTGAGCCTCTGCAGCACCCAGCCAGATGGGAACGTGGTCATCGCCTGC', 'IGHA2':'GCATCCCCGACCAGCCCCAAGGTCTTCCCGCTGAGCCTCGACAGCACCCCCCAAGATGGGAACGTGGTCGTCGCATGC'}, 'IGLC7':{ 'IGLC':'GTCAGCCCAAGGCTGCCCCCTCGGTCACTCTGTTCCCGCCCTCCTCTGAGGAGCTTCAAGCCAACAAGGCCACACTGGTGTGTCTCATAA', 'IGLC7':'GTCAGCCCAAGGCTGCCCCCTCGGTCACTCTGTTCCCACCCTCCTCTGAGGAGCTTCAAGCCAACAAGGCCACACTGGTGTGTCTCGTAA'}, 'IGLC3':{ 'IGLC':'GTCAGCCCAAGGCTGCCCCCTCGGTCACTCTGTTCCCGCCCTCCTCTGAGGAGCTTCAAGCCAACAAGGCCACACTGGTGTGTCTCATAA', 'IGLC3':'GTCAGCCCAAGGCTGCCCCCTCGGTCACTCTGTTCCCACCCTCCTCTGAGGAGCTTCAAGCCAACAAGGCCACACTGGTGTGTCTCATAA'}, 'IGLC6':{ 'IGLC': 'TCGGTCACTCTGTTCCCGCCCTCCTCTGAGGAGCTTCAAGCCAACAAGGCCACACTGGTGTGTCTCA', 'IGLC6':'TCGGTCACTCTGTTCCCGCCCTCCTCTGAGGAGCTTCAAGCCAACAAGGCCACACTGGTGTGCCTGA'}} else: primer_dict = primers_dict for i in dat.index: if (dat.loc[i, 'c_call'] is not np.nan) & (dat.loc[i, 'c_call'] is not None): for k in primer_dict: if k in dat.loc[i, 'c_call']: if len(primer_dict[k]) == 2: two_gene_correction(dat, i, primer_dict[k]) elif len(primer_dict[k]) == 3: three_gene_correction(dat, i, primer_dict[k]) elif len(primer_dict[k]) == 4: four_gene_correction(dat, i, primer_dict[k]) return(dat) # main function from here format_dict = {'changeo':'_igblast_db-pass', 'blast':'_igblast_db-pass', 'airr':'_igblast_gap'} filePath = None if os.path.isfile(str(fasta)) and str(fasta).endswith(".fasta"): filePath = fasta elif os.path.isdir(str(fasta)): files = os.listdir(fasta) for file in files: if os.path.isdir(fasta.rstrip('/') + '/' + os.path.basename(file)): if file == 'dandelion': if 'data' in os.listdir(fasta.rstrip('/') + '/' + os.path.basename(file)): out_ = fasta.rstrip('/') + '/' + os.path.basename(file) + '/data/' for x in os.listdir(os.path.abspath(out_)): if x.endswith('.fasta'): filePath = out_ + x else: out_ = fasta.rstrip('/') + '/' + os.path.basename(file) for x in os.listdir(out_): if x.endswith('.fasta'): filePath = out_ + '/' + x if filePath is None: raise OSError('Path to fasta file is unknown. Please specify path to fasta file or folder containing fasta file.') if verbose: print('Processing {} \n'.format(filePath)) # running blast using blast if verbose: print('Running blastn \n') _run_blastn(filePath, blastdb, format_dict[fileformat], org, verbose) # parsing output into a summary.txt file if verbose: print('Parsing blast output \n') _parse_BLAST(filePath, format_dict[fileformat]) # Add the c_calls to the data file c_seq, c_germ, c_call, c_ident, c_supp, c_scr, c_st, c_en = {}, {}, {}, {}, {}, {}, {}, {} c_seq, c_germ, c_call, c_ident, c_supp, c_scr, c_st, c_en = _get_C(filePath, format_dict[fileformat], allele, parallel, ncpu) _file = "{}/tmp/{}_genotyped.tsv".format(os.path.dirname(filePath), os.path.basename(filePath).split('.fasta')[0]+format_dict[fileformat]) _airrfile = "{}/tmp/{}.tsv".format(os.path.dirname(filePath), os.path.basename(filePath).split('.fasta')[0]+'_igblast') _file2 = "{}/{}_genotyped.tsv".format(os.path.dirname(filePath), os.path.basename(filePath).split('.fasta')[0]+format_dict[fileformat]) if verbose: print('Loading 10X annotations \n') dat_10x = load_data(_file) res_10x = pd.DataFrame(dat_10x['c_call']) res_10x['c_call'] = res_10x['c_call'].fillna(value='None') if verbose: print('Preparing new calls \n') dat = _transfer_c(_file, c_call, 'c_call') dat = _transfer_c(dat, c_seq, 'c_sequence_alignment') dat = _transfer_c(dat, c_germ, 'c_germline_alignment') dat = _transfer_c(dat, c_st, 'c_sequence_start') dat = _transfer_c(dat, c_en, 'c_sequence_end') dat = _transfer_c(dat, c_scr, 'c_score') dat = _transfer_c(dat, c_ident, 'c_identity') dat = _transfer_c(dat, c_supp, 'c_support') res_blast = pd.DataFrame(dat['c_call']) res_blast = res_blast.fillna(value='None') res_10x_sum = pd.DataFrame(res_10x['c_call'].value_counts(normalize=True)*100) res_blast_sum = pd.DataFrame(res_blast['c_call'].value_counts(normalize=True)*100) res_10x_sum['group'] = '10X' res_blast_sum['group'] = 'blast' res_10x_sum.columns = ['counts', 'group'] res_blast_sum.columns = ['counts', 'group'] res_10x_sum.index = res_10x_sum.index.set_names(['c_call']) res_blast_sum.index = res_blast_sum.index.set_names(['c_call']) res_10x_sum.reset_index(drop = False, inplace = True) res_blast_sum.reset_index(drop = False, inplace = True) if correct_c_call: # TODO: figure out if i need to set up a None correction? if verbose: print('Correcting C calls \n') dat = _correct_c_call(dat, primers_dict=correction_dict) res_corrected = pd.DataFrame(dat['c_call']) res_corrected = res_corrected.fillna(value='None') res_corrected_sum = pd.DataFrame(res_corrected['c_call'].value_counts(normalize=True)*100) res_corrected_sum['group'] = 'corrected' res_corrected_sum.columns = ['counts', 'group'] res_corrected_sum.index = res_corrected_sum.index.set_names(['c_call']) res_corrected_sum.reset_index(drop = False, inplace = True) res = pd.concat([res_10x_sum, res_blast_sum, res_corrected_sum]) else: res = pd.concat([res_10x_sum, res_blast_sum]) res = res.reset_index(drop = True) res['c_call'] = res['c_call'].astype('category') res['c_call'] = res['c_call'].cat.reorder_categories(sorted(list(set(res['c_call'])), reverse=True)) if verbose: print('Finishing up \n') if 'cell_id' not in dat.columns: dat = _add_cell(dat) dat['c_call_10x'] = pd.Series(dat_10x['c_call']) # some minor adjustment to the final output table airr_output = load_data(_airrfile) cols_to_merge = ['junction_aa_length', 'fwr1_aa', 'fwr2_aa', 'fwr3_aa', 'fwr4_aa', 'cdr1_aa', 'cdr2_aa', 'cdr3_aa', 'sequence_alignment_aa', 'v_sequence_alignment_aa', 'd_sequence_alignment_aa', 'j_sequence_alignment_aa'] for x in cols_to_merge: dat[x] = pd.Series(airr_output[x]) dat.to_csv(_file2, sep = '\t', index=False) if plot: options.figure_size = figsize if correct_c_call: p = (ggplot(res, aes(x='c_call', y = 'counts', fill='group')) + coord_flip() + theme_classic() + xlab("c_call") + ylab("% c calls") + geom_col(stat="identity", position = 'dodge') + scale_fill_manual(values=('#79706e','#86bcb6', '#F28e2b')) + theme(legend_title = element_blank())) else: p = (ggplot(res, aes(x='c_call', y = 'counts', fill='group')) + coord_flip() + theme_classic() + xlab("c_call") + ylab("% c calls") + geom_col(stat="identity", position = 'dodge') + scale_fill_manual(values=('#79706e','#86bcb6')) + theme(legend_title = element_blank())) print(p)
[docs]def assign_isotypes(fastas, fileformat = 'blast', org = 'human', correct_c_call = True, correction_dict = None, plot = True, figsize=(4,4), blastdb = None, allele = False, parallel = True, ncpu = None, verbose = False): """ Annotate contigs with constant region call using blastn Parameters ---------- fastas : list list or sequence of paths to fasta files. fileformat : str format of V(D)J file/objects. Default is 'blast'. Also accepts 'changeo' (same behaviour as 'blast') and 'airr'. org : str organism of reference folder. Default is 'human'. correct_c_call : bool whether or not to adjust the c_calls after blast based on provided primers specified in `primer_dict` option. Default is True. correction_dict : dict[dict], optional a nested dictionary contain isotype/c_genes as keys and primer sequences as records to use for correcting annotated c_calls. Defaults to a curated dictionary for human sequences if left as none. plot : bool whether or not to plot reassignment summary metrics. Default is True. figsize : tuple[float, float] size of figure. Default is (4, 4). blastdb : str, optional path to blast database. Defaults to `$BLASTDB` environmental variable. allele : bool whether or not to return allele calls. Default is False. parallel : bool whether or not to use parallelization. Default is True. ncpu : int number of cores to use if parallel is True. Default is all available - 1. verbose : bool whether or not to print the blast command in terminal. Default is False. Returns ------- V(D)J tsv files with constant genes annotated. """ if type(fastas) is not list: fastas = [fastas] if verbose: print('Assign isotypes \n') for fasta in fastas: assign_isotype(fasta, fileformat = fileformat, org = org, correct_c_call = correct_c_call, correction_dict = correction_dict, plot = plot, figsize=figsize, blastdb = blastdb, allele = allele, parallel = parallel, ncpu = ncpu, verbose = verbose)
[docs]def reannotate_genes(data, igblast_db = None, germline = None, org ='human', loci = 'ig', extended = True, verbose = False): """ Reannotate cellranger fasta files with igblastn and parses to airr/changeo data format. Parameters ---------- data : list list or sequence of fasta file locations, or folder name containing fasta files. if provided as a single string, it will first be converted to a list; this allows for the function to be run on single/multiple samples. igblast_db : str, optional path to igblast database folder. Defaults to `$IGDATA` environmental variable. germline : str, optional path to germline database folder. Defaults to `$GERMLINE` environmental variable. org : str organism of germline database. Default is 'human'. loci : str mode for igblastn. Default is 'ig' for BCRs. Also accepts 'tr' for TCRs. extended : bool whether or not to transfer additional 10X annotions to output file. Default is True. verbose : whether or not to print the igblast command used in the terminal. Default is False. Returns ------- V(D)J data file in airr/changeo data format. """ if type(data) is not list: data = [data] filePath = None for s in tqdm(data, desc = 'Assigning genes '): if os.path.isfile(str(s)) and str(s).endswith(".fasta"): filePath = s elif os.path.isdir(str(s)): files = os.listdir(s) for file in files: if os.path.isdir(s.rstrip('/') + '/' + os.path.basename(file)): if file == 'dandelion': if 'data' in os.listdir(s.rstrip('/') + '/' + os.path.basename(file)): out_ = s.rstrip('/') + '/' + os.path.basename(file) + '/data/' for x in os.listdir(out_): if x.endswith('.fasta'): filePath = out_ + x else: out_ = s.rstrip('/') + '/' + os.path.basename(file) for x in os.listdir(out_): if x.endswith('.fasta'): filePath = out_ + '/' + x if filePath is None: raise OSError('Path to fasta file for {} is unknown. Please specify path to fasta file or folder containing fasta file.'.format(s)) if verbose: print('Processing {} \n'.format(filePath)) assigngenes_igblast(filePath, igblast_db=igblast_db, org = org, loci=loci, verbose = verbose) makedb_igblast(filePath, org = org, germline = germline, extended = extended, verbose = verbose)
[docs]def reassign_alleles(data, combined_folder, v_germline = None, germline = None, org = 'human', v_field='v_call_genotyped', germ_types='dmask', novel = True, cloned = False, plot = True, figsize = (4,3), sample_id_dictionary = None, verbose = False, ): """ Correct allele calls based on a personalized genotype using tigger-reassignAlleles. It uses a subject-specific genotype to correct correct preliminary allele assignments of a set of sequences derived from a single subject. Parameters ---------- data : list list or sequence of data folders containing the .tsv files. if provided as a single string, it will first be converted to a list; this allows for the function to be run on single/multiple samples. combined_folder : str name of folder for concatenated data file and genotyped files. v_germline : str, optional path to heavy chain v germline fasta. Defaults to IGHV fasta in `$GERMLINE` environmental variable. germline : str, optional path to germline database folder. Defaults to `$GERMLINE` environmental variable. org : str organism of germline database. Default is 'human'. v_field : str name of column containing the germline V segment call. Default is 'v_call_genotyped' (airr) for after tigger. germ_types : str Specify type of germline for reconstruction. Accepts one of : 'full', 'dmask', 'vonly', 'region'. Default is 'dmask'. novel : bool whether or not to run novel allele discovery during tigger-genotyping. Default is True (yes). cloned : bool whether or not to run CreateGermlines.py with `--cloned`. plot : bool whether or not to plot reassignment summary metrics. Default is True. figsize : tuple[float, float] size of figure. Default is (4, 3). sample_id_dictionary : dict, optional dictionary for creating a sample_id column in the concatenated file. verbose : bool Whether or not to print the command used in the terminal. Default is False. Returns ------- Individual V(D)J data files with v_call_genotyped column containing reassigned heavy chain v calls """ fileformat = 'blast' if type(data) is not list: data = [data] informat_dict = {'changeo':'_igblast_db-pass.tsv', 'blast':'_igblast_db-pass.tsv', 'airr':'_igblast_gap.tsv'} germpass_dict = {'changeo':'_igblast_db-pass_germ-pass.tsv', 'blast':'_igblast_db-pass_germ-pass.tsv', 'airr':'_igblast_gap_germ-pass.tsv'} heavy_dict = {'changeo':'_igblast_db-pass_heavy_parse-select.tsv', 'blast':'_igblast_db-pass_heavy_parse-select.tsv', 'airr':'_igblast_gap_heavy_parse-select.tsv'} light_dict = {'changeo':'_igblast_db-pass_light_parse-select.tsv', 'blast':'_igblast_db-pass_light_parse-select.tsv', 'airr':'_igblast_gap_light_parse-select.tsv'} fileformat_dict = {'changeo':'_igblast_db-pass_genotyped.tsv', 'blast':'_igblast_db-pass_genotyped.tsv', 'airr':'_igblast_gap_genotyped.tsv'} fileformat_passed_dict = {'changeo':'_igblast_db-pass_genotyped_germ-pass.tsv', 'blast':'_igblast_db-pass_genotyped_germ-pass.tsv', 'airr':'_igblast_gap_genotyped_germ-pass.tsv'} inferred_fileformat_dict = {'changeo':'_igblast_db-pass_inferredGenotype.txt', 'blast':'_igblast_db-pass_inferredGenotype.txt', 'airr':'_igblast_gap_inferredGenotype.txt'} germline_dict = {'changeo':'_igblast_db-pass_genotype.fasta', 'blast':'_igblast_db-pass_genotype.fasta', 'airr':'_igblast_gap_genotype.fasta'} fform_dict = {'blast':'airr', 'airr':'airr', 'changeo':'changeo'} filepathlist_heavy = [] filepathlist_light = [] filePath = None sampleNames_dict = {} filePath_dict = {} for s in tqdm(data, desc = 'Processing data file(s) '): if os.path.isfile(str(s)) and str(s).endswith(informat_dict[fileformat]): filePath = s elif os.path.isdir(str(s)): files = os.listdir(s) for file in files: if os.path.isdir(s.rstrip('/') + '/' + os.path.basename(file)): if file == 'dandelion': if 'data' in os.listdir(s.rstrip('/') + '/' + os.path.basename(file)): out_ = s + '/' + os.path.basename(file) + '/data/tmp/' for x in os.listdir(out_): if x.endswith(informat_dict[fileformat]): filePath = out_ + x filePath_heavy = out_ + x.replace(informat_dict[fileformat], heavy_dict[fileformat]) filePath_light = out_ + x.replace(informat_dict[fileformat], light_dict[fileformat]) else: out_ = s.rstrip('/') + '/' + os.path.basename(file) for x in os.listdir(out_): if x.endswith(informat_dict[fileformat]): filePath = out_ + '/' + x filePath_heavy = out_ + '/' + x.replace(informat_dict[fileformat], heavy_dict[fileformat]) filePath_light = out_ + '/' + x.replace(informat_dict[fileformat], light_dict[fileformat]) if filePath is None: raise OSError('Path to .tsv file for {} is unknown. Please specify path to reannotated .tsv file or folder containing reannotated .tsv file.'.format(s)) if sample_id_dictionary is not None: sampleNames_dict[filePath] = sample_id_dictionary[s] else: sampleNames_dict[filePath] = str(s) filePath_dict[str(s)] = filePath # splitting up to heavy chain and light chain files parsedb_heavy(filePath) parsedb_light(filePath) # add to counter filepathlist_heavy.append(filePath_heavy) filepathlist_light.append(filePath_light) # make output directory outDir = combined_folder.rstrip('/') if not os.path.exists(outDir): os.makedirs(outDir) # concatenate if len(filepathlist_heavy) > 1: print('Concatenating objects') cmd1 = ' '.join(['cat'] + [f for f in filepathlist_heavy] + ['>'] + [outDir+'/'+outDir+'_heavy'+informat_dict[fileformat]]) cmd2 = ' '.join(['cat'] + [f for f in filepathlist_light] + ['>'] + [outDir+'/'+outDir+'_light'+informat_dict[fileformat]]) else: cmd1 = ' '.join(['cat'] + [filepathlist_heavy[0]] + ['>'] + [outDir+'/'+outDir+'_heavy'+informat_dict[fileformat]]) cmd2 = ' '.join(['cat'] + [filepathlist_light[0]] + ['>'] + [outDir+'/'+outDir+'_light'+informat_dict[fileformat]]) if verbose: print('Running command: %s\n' % (cmd1)) print('Running command: %s\n' % (cmd2)) os.system(cmd1) os.system(cmd2) novel_dict = {True:'YES', False:'NO'} if novel: try: print(' Running tigger-genotype with novel allele discovery.') tigger_genotype(outDir+'/'+outDir+'_heavy'+informat_dict[fileformat], v_germline = v_germline, fileformat = fform_dict[fileformat], novel_ = novel_dict[novel], verbose = verbose) creategermlines(outDir+'/'+outDir+'_heavy'+fileformat_dict[fileformat], germtypes = germ_types, mode = 'heavy', genotype_fasta = outDir+'/'+outDir+'_heavy'+germline_dict[fileformat], germline = germline, v_field = v_field, verbose = verbose, cloned = cloned) _ = load_data(outDir+'/'+outDir+'_heavy'+fileformat_passed_dict[fileformat]) except: try: print(' Novel allele discovery execution halted.') print(' Attempting to run tigger-genotype without novel allele discovery.') tigger_genotype(outDir+'/'+outDir+'_heavy'+informat_dict[fileformat], v_germline = v_germline, fileformat = fform_dict[fileformat], novel_ = novel_dict[False], verbose = verbose) creategermlines(outDir+'/'+outDir+'_heavy'+fileformat_dict[fileformat], germtypes = germ_types, mode = 'heavy', genotype_fasta = outDir+'/'+outDir+'_heavy'+germline_dict[fileformat], germline = germline, v_field = v_field, verbose = verbose, cloned = cloned) _ = load_data(outDir+'/'+outDir+'_heavy'+fileformat_passed_dict[fileformat]) except: print(' Insufficient contigs for running tigger-genotype. Defaulting to original heavy chain v_calls.') tigger_failed = '' else: try: print(' Running tigger-genotype without novel allele discovery.') tigger_genotype(outDir+'/'+outDir+'_heavy'+informat_dict[fileformat], v_germline = v_germline, fileformat = fform_dict[fileformat], novel_ = novel_dict[False], verbose = verbose) creategermlines(outDir+'/'+outDir+'_heavy'+fileformat_dict[fileformat], germtypes = germ_types, mode = 'heavy', genotype_fasta = outDir+'/'+outDir+'_heavy'+germline_dict[fileformat], germline = germline, v_field = v_field, verbose = verbose, cloned = cloned) _ = load_data(outDir+'/'+outDir+'_heavy'+fileformat_passed_dict[fileformat]) except: print(' Insufficient contigs for running tigger-genotype. Defaulting to original heavy chain v_calls.') tigger_failed = '' if 'tigger_failed' in locals(): creategermlines(outDir+'/'+outDir+'_heavy'+informat_dict[fileformat], germtypes = germ_types, mode = 'heavy', genotype_fasta = None, germline = germline, v_field = 'v_call', verbose = verbose, cloned = cloned) creategermlines(outDir+'/'+outDir+'_light'+informat_dict[fileformat], germtypes = germ_types, mode = 'light', genotype_fasta = None, germline = germline, v_field = 'v_call', verbose = verbose, cloned = cloned) print(' For convenience, entries for heavy chain in `v_call` are copied to `v_call_genotyped`.') heavy = load_data(outDir+'/'+outDir+'_heavy'+germpass_dict[fileformat]) heavy['v_call_genotyped'] = heavy['v_call'] print(' For convenience, entries for light chain `v_call` are copied to `v_call_genotyped`.') light = load_data(outDir+'/'+outDir+'_light'+germpass_dict[fileformat]) light['v_call_genotyped'] = light['v_call'] else: creategermlines(outDir+'/'+outDir+'_light'+informat_dict[fileformat], germtypes = germ_types, mode = 'light', genotype_fasta = None, germline = germline, v_field = 'v_call', verbose = verbose, cloned = cloned) heavy = load_data(outDir+'/'+outDir+'_heavy'+fileformat_passed_dict[fileformat]) print(' For convenience, entries for light chain `v_call` are copied to `v_call_genotyped`.') light = load_data(outDir+'/'+outDir+'_light'+germpass_dict[fileformat]) light['v_call_genotyped'] = light['v_call'] sampledict = {} heavy['sample_id'], light['sample_id'] = None, None for file in sampleNames_dict.keys(): dat_f = load_data(file) dat_f['sample_id'] = sampleNames_dict[file] heavy['sample_id'].update(dat_f['sample_id']) light['sample_id'].update(dat_f['sample_id']) dat_ = heavy.append(light) if 'cell_id' in dat_.columns: dat_.sort_values(by = 'cell_id', inplace=True) else: dat_.sort_values(by = 'sequence_id', inplace=True) if plot: if 'tigger_failed' not in locals(): print('Returning summary plot') inferred_genotype = outDir+'/'+outDir+'_heavy'+inferred_fileformat_dict[fileformat] inf_geno = pd.read_csv(inferred_genotype, sep = '\t', dtype = 'object') s2 = set(inf_geno['gene']) results = [] for samp in list(set(heavy['sample_id'])): res_x = heavy[(heavy['sample_id']==samp)] V_ = [re.sub('[*][0-9][0-9]', '', v) for v in res_x['v_call']] V_g = [re.sub('[*][0-9][0-9]', '', v) for v in res_x['v_call_genotyped']] s1 = set(list(','.join([','.join(list(set(v.split(',')))) for v in V_]).split(','))) setdiff = s1 - s2 ambiguous = (["," in i for i in V_].count(True)/len(V_)*100, ["," in i for i in V_g].count(True)/len(V_g)*100) not_in_genotype=([i in setdiff for i in V_].count(True)/len(V_)*100, [i in setdiff for i in V_g].count(True)/len(V_g)*100) stats = pd.DataFrame([ambiguous,not_in_genotype], columns = ['ambiguous', 'not_in_genotype'], index = ['before', 'after']).T stats.index.set_names(['vgroup'], inplace = True) stats.reset_index(drop = False, inplace = True) stats['sample_id'] = samp # stats['donor'] = str(combined_folder) results.append(stats) results = pd.concat(results) ambiguous_table = results[results['vgroup'] == 'ambiguous'] not_in_genotype_table = results[results['vgroup'] == 'not_in_genotype'] ambiguous_table.reset_index(inplace = True, drop = True) not_in_genotype_table.reset_index(inplace = True, drop = True) # melting the dataframe ambiguous_table_before = ambiguous_table.drop('after', axis = 1) ambiguous_table_before.rename(columns={"before": "var"}, inplace = True) ambiguous_table_before['var_group'] = 'before' ambiguous_table_after = ambiguous_table.drop('before', axis = 1) ambiguous_table_after.rename(columns={"after": "var"}, inplace = True) ambiguous_table_after['var_group'] = 'after' ambiguous_table = pd.concat([ambiguous_table_before, ambiguous_table_after]) not_in_genotype_table_before = not_in_genotype_table.drop('after', axis = 1) not_in_genotype_table_before.rename(columns={"before": "var"}, inplace = True) not_in_genotype_table_before['var_group'] = 'before' not_in_genotype_table_after = not_in_genotype_table.drop('before', axis = 1) not_in_genotype_table_after.rename(columns={"after": "var"}, inplace = True) not_in_genotype_table_after['var_group'] = 'after' not_in_genotype_table = pd.concat([not_in_genotype_table_before, not_in_genotype_table_after]) ambiguous_table['var_group'] = ambiguous_table['var_group'].astype('category') not_in_genotype_table['var_group'] = not_in_genotype_table['var_group'].astype('category') ambiguous_table['var_group'].cat.reorder_categories(['before', 'after'], inplace = True) not_in_genotype_table['var_group'].cat.reorder_categories(['before', 'after'], inplace = True) options.figure_size = figsize final_table = pd.concat([ambiguous_table, not_in_genotype_table]) p = (ggplot(final_table, aes(x='sample_id', y = 'var', fill='var_group')) + coord_flip() + theme_classic() + xlab("sample_id") + ylab("% allele calls") + ggtitle("Genotype reassignment with TIgGER") + geom_bar(stat="identity") + facet_grid('~'+str('vgroup'), scales="free_y") + scale_fill_manual(values=('#86bcb6', '#F28e2b')) + theme(legend_title = element_blank())) print(p) else: pass sleep(0.5) # if split_write_out: if 'tigger_failed' in locals(): print('Although tigger-genotype was not run successfully, file will still be saved with `_genotyped.tsv` extension for convenience.') for s in tqdm(data, desc = 'Writing out to individual folders '): if sample_id_dictionary is not None: out_file = dat_[dat_['sample_id'] == sample_id_dictionary[s]] else: out_file = dat_[dat_['sample_id'] == s] outfilepath = filePath_dict[s] out_file.to_csv(outfilepath.replace('.tsv', '_genotyped.tsv'), index = False, sep = '\t')
def reassign_alleles_(data, combined_folder, germline = None, org = 'human', fileformat = 'blast', seq_field = 'sequence_alignment', v_field='v_call_genotyped', d_field='d_call', j_field='j_call', germ_types='dmask', novel = True, plot = True, figsize = (4,3), sample_id_dictionary = None, verbose = False): """ Correct allele calls based on a personalized genotype using tigger-reassignAlleles. It uses a subject-specific genotype to correct correct preliminary allele assignments of a set of sequences derived from a single subject. Parameters ---------- data : list list or sequence of data folders containing the .tsv files. if provided as a single string, it will first be converted to a list; this allows for the function to be run on single/multiple samples. combined_folder : str name of folder for concatenated data file and genotyped files. germline : str, optional path to germline database folder. Defaults to `$GERMLINE` environmental variable. org : str organism of germline database. Default is 'human'. fileformat : str format of V(D)J file/objects. Default is 'blast'. Also accepts 'changeo' (same behaviour as 'blast') and 'airr'. org : str organism of germline database. Default is 'human'. seq_field : str name of column containing the aligned sequence. Default is 'sequence_alignment' (airr). v_field : str name of column containing the germline V segment call. Default is 'v_call_genotyped' (airr) after tigger. d_field : str name of column containing the germline d segment call. Default is 'd_call' (airr). j_field : str name of column containing the germline j segment call. Default is 'j_call' (airr). germ_types : str Specify type(s) of germlines to include full germline, germline with D segment masked, or germline for V segment only. Default is 'dmask'. novel : bool whether or not to run novel allele discovery during tigger-genotyping. Default is True (yes). plot : bool whether or not to plot reassignment summary metrics. Default is True. figsize : tuple[float, float] size of figure. Default is (4, 3). sample_id_dictionary : dict, optional dictionary for creating a sample_id column in the concatenated file. verbose : bool Whether or not to print the command used in the terminal. Default is False. Returns ------- Individual V(D)J data files with v_call_genotyped column containing reassigned heavy chain v calls """ if type(data) is not list: data = [data] informat_dict = {'changeo':'_igblast_db-pass.tsv', 'blast':'_igblast_db-pass.tsv', 'airr':'_igblast_gap.tsv'} fileformat_dict = {'changeo':'_igblast_db-pass_genotyped.tsv', 'blast':'_igblast_db-pass_genotyped.tsv', 'airr':'_igblast_gap_genotyped.tsv'} inferred_fileformat_dict = {'changeo':'_igblast_db-pass_inferredGenotype.txt', 'blast':'_igblast_db-pass_inferredGenotype.txt', 'airr':'_igblast_gap_inferredGenotype.txt'} germline_dict = {'changeo':'_igblast_db-pass_genotype.fasta', 'blast':'_igblast_db-pass_genotype.fasta', 'airr':'_igblast_gap_genotype.fasta'} fform_dict = {'blast':'airr', 'airr':'airr', 'changeo':'changeo'} data_list = [] filePath = None for s in tqdm(data, desc = 'Processing data file(s) '): if os.path.isfile(str(s)) and str(s).endswith(informat_dict[fileformat]): filePath = s elif os.path.isdir(str(s)): files = os.listdir(s) for file in files: if os.path.isdir(s.rstrip('/') + '/' + os.path.basename(file)): if file == 'dandelion': if 'data' in os.listdir(s.rstrip('/') + '/' + os.path.basename(file)): out_ = s + '/' + os.path.basename(file) + '/data/' for x in os.listdir(out_): if x.endswith(informat_dict[fileformat]): filePath = out_ + x else: out_ = s.rstrip('/') + '/' + os.path.basename(file) for x in os.listdir(out_): if x.endswith(informat_dict[fileformat]): filePath = out_ + '/' + x if filePath is None: raise OSError('Path to .tsv file for {} is unknown. Please specify path to reannotated .tsv file or folder containing reannotated .tsv file.'.format(s)) dat = load_data(filePath) if sample_id_dictionary is not None: dat['sample_id'] = sample_id_dictionary[s] else: dat['sample_id'] = str(s) data_list.append(dat) # concatenate if len(data_list) > 1: print('Concatenating objects') dat_ = pd.concat(data_list, sort=False) else: dat_ = data_list[0] # write out this file for tigger outDir = combined_folder.rstrip('/') if not os.path.exists(outDir): os.makedirs(outDir) novel_dict = {True:'YES', False:'NO'} print(' Writing out concatenated object') # dat_.to_csv(outDir+'filtered_contig'+informat_dict[fileformat], index = False, sep = '\t', na_rep='') dat_h = dat_[dat_['locus'] == 'IGH'] dat_h.to_csv(outDir+'/'+outDir+'_heavy'+informat_dict[fileformat], index = False, sep = '\t', na_rep='') if novel: try: print(' Running tigger-genotype with novel allele discovery.') tigger_genotype(outDir+'/'+outDir+'_heavy'+informat_dict[fileformat], germline = germline, fileformat = fform_dict[fileformat], novel_ = novel_dict[novel], verbose = verbose) out_h = load_data(outDir+'/'+outDir+'_heavy'+fileformat_dict[fileformat]) dat_['v_call_genotyped'] = pd.Series(out_h['v_call_genotyped']) except: try: print(' Novel allele discovery exceution halted.') print(' Attempting to run tigger-genotype without novel allele discovery.') tigger_genotype(outDir+'/'+outDir+'_heavy'+informat_dict[fileformat], germline = germline, fileformat = fform_dict[fileformat], novel_ = novel_dict[False], verbose = verbose) out_h = load_data(outDir+'/'+outDir+'_heavy'+fileformat_dict[fileformat]) dat_['v_call_genotyped'] = pd.Series(out_h['v_call_genotyped']) tigger_novel_failed = '' except: print(' Insufficient contigs for running tigger-genotype. Defaulting to using original v_calls.') out_h = dat_h.copy() print(' For convenience, entries in `v_call` are copied to `v_call_genotyped`.') dat_['v_call_genotyped'] = pd.Series(out_h['v_call']) tigger_failed = '' else: try: print(' Running tigger-genotype without novel allele discovery.') tigger_genotype(outDir+'/'+outDir+'_heavy'+informat_dict[fileformat], germline = germline, fileformat = fform_dict[fileformat], novel_ = novel_dict[False], verbose = verbose) out_h = load_data(outDir+'/'+outDir+'_heavy'+fileformat_dict[fileformat]) dat_['v_call_genotyped'] = pd.Series(out_h['v_call_genotyped']) tigger_novel_failed = '' except: print(' Insufficient contigs for running tigger-genotype. Defaulting to using original v_calls.') out_h = dat_h.copy() print(' For convenience, entries in `v_call` are copied to `v_call_genotyped`.') dat_['v_call_genotyped'] = pd.Series(out_h['v_call']) tigger_failed = '' # transfer light chain V calls to v_call_genotyped as well print(' For convenience, entries for light chain `v_call` are copied to `v_call_genotyped`.') dat_['v_call_genotyped'].update(dat_[~(dat_['locus'] == 'IGH')]['v_call']) res = Dandelion(dat_, initialize = False) # update with the personalized germline database res.update_germline(corrected = outDir+'/'+outDir+'_heavy'+germline_dict[fileformat], germline = germline, org = org) create_germlines(res, germline = germline, org = org, seq_field = seq_field, v_field = v_field, d_field = d_field, j_field = j_field, germ_types = germ_types, fileformat = fform_dict[fileformat]) germtypedict = {'dmask':'germline_alignment_d_mask', 'full':'germline_alignment', 'vonly':'germline_alignment_v_region', 'regions':'germline_regions'} if novel: if 'tigger_novel_failed' or 'tigger_failed' in locals(): print('Germline reconstruction with `{}` has failed. Re-running with original v_call.'.format(v_field)) res.update_germline(corrected = None, germline = germline, org = org) create_germlines(res, germline = germline, org = org, seq_field = seq_field, v_field = 'v_call', d_field = d_field, j_field = j_field, germ_types = germ_types, fileformat = fform_dict[fileformat]) print(' Saving corrected genotyped object') sleep(0.5) res.data.to_csv(outDir+'/'+outDir+fileformat_dict[fileformat], index = False, sep = '\t') # reset dat_ dat_ = res.data.copy() if plot: print('Returning summary plot') inferred_genotype = outDir+'/'+outDir+'_heavy'+inferred_fileformat_dict[fileformat] inf_geno = pd.read_csv(inferred_genotype, sep = '\t', dtype = 'object') s2 = set(inf_geno['gene']) results = [] for samp in list(set(out_h['sample_id'])): res_x = out_h[(out_h['sample_id']==samp)] V_ = [re.sub('[*][0-9][0-9]', '', v) for v in res_x['v_call']] V_g = [re.sub('[*][0-9][0-9]', '', v) for v in res_x['v_call_genotyped']] s1 = set(list(','.join([','.join(list(set(v.split(',')))) for v in V_]).split(','))) setdiff = s1 - s2 ambiguous = (["," in i for i in V_].count(True)/len(V_)*100, ["," in i for i in V_g].count(True)/len(V_g)*100) not_in_genotype=([i in setdiff for i in V_].count(True)/len(V_)*100, [i in setdiff for i in V_g].count(True)/len(V_g)*100) stats = pd.DataFrame([ambiguous,not_in_genotype], columns = ['ambiguous', 'not_in_genotype'], index = ['before', 'after']).T stats.index.set_names(['vgroup'], inplace = True) stats.reset_index(drop = False, inplace = True) stats['sample_id'] = samp # stats['donor'] = str(combined_folder) results.append(stats) results = pd.concat(results) ambiguous_table = results[results['vgroup'] == 'ambiguous'] not_in_genotype_table = results[results['vgroup'] == 'not_in_genotype'] ambiguous_table.reset_index(inplace = True, drop = True) not_in_genotype_table.reset_index(inplace = True, drop = True) # melting the dataframe ambiguous_table_before = ambiguous_table.drop('after', axis = 1) ambiguous_table_before.rename(columns={"before": "var"}, inplace = True) ambiguous_table_before['var_group'] = 'before' ambiguous_table_after = ambiguous_table.drop('before', axis = 1) ambiguous_table_after.rename(columns={"after": "var"}, inplace = True) ambiguous_table_after['var_group'] = 'after' ambiguous_table = pd.concat([ambiguous_table_before, ambiguous_table_after]) not_in_genotype_table_before = not_in_genotype_table.drop('after', axis = 1) not_in_genotype_table_before.rename(columns={"before": "var"}, inplace = True) not_in_genotype_table_before['var_group'] = 'before' not_in_genotype_table_after = not_in_genotype_table.drop('before', axis = 1) not_in_genotype_table_after.rename(columns={"after": "var"}, inplace = True) not_in_genotype_table_after['var_group'] = 'after' not_in_genotype_table = pd.concat([not_in_genotype_table_before, not_in_genotype_table_after]) ambiguous_table['var_group'] = ambiguous_table['var_group'].astype('category') not_in_genotype_table['var_group'] = not_in_genotype_table['var_group'].astype('category') ambiguous_table['var_group'].cat.reorder_categories(['before', 'after'], inplace = True) not_in_genotype_table['var_group'].cat.reorder_categories(['before', 'after'], inplace = True) options.figure_size = figsize final_table = pd.concat([ambiguous_table, not_in_genotype_table]) p = (ggplot(final_table, aes(x='sample_id', y = 'var', fill='var_group')) + coord_flip() + theme_classic() + xlab("sample_id") + ylab("% allele calls") + ggtitle("Genotype reassignment with TIgGER") + geom_bar(stat="identity") + facet_grid('~'+str('vgroup'), scales="free_y") + scale_fill_manual(values=('#86bcb6', '#F28e2b')) + theme(legend_title = element_blank())) print(p) sleep(0.5) # if split_write_out: for s in tqdm(data, desc = 'Writing out to individual folders '): if sample_id_dictionary is not None: out_file = dat_[dat_['sample_id'] == sample_id_dictionary[s]] else: out_file = dat_[dat_['sample_id'] == s] if os.path.isfile(str(s)) and str(s).endswith(informat_dict[fileformat]): filePath = s elif os.path.isdir(str(s)): files = os.listdir(s) for file in files: if os.path.isdir(s.rstrip('/') + '/' + os.path.basename(file)): if file == 'dandelion': if 'data' in os.listdir(s.rstrip('/') + '/' + os.path.basename(file)): out_ = s + '/' + os.path.basename(file) + '/data/' for x in os.listdir(out_): if x.endswith(informat_dict[fileformat]): filePath = out_ + x else: out_ = s.rstrip('/') + '/' + os.path.basename(file) for x in os.listdir(out_): if x.endswith(informat_dict[fileformat]): filePath = out_ + '/' + x out_file.to_csv(filePath.replace('.tsv', '_genotyped.tsv'), index = False, sep = '\t')
[docs]def create_germlines(self, germline = None, org = 'human', seq_field='sequence_alignment', v_field='v_call', d_field='d_call', j_field='j_call', germ_types='dmask', fileformat='airr', initialize_metadata = False): """ Runs CreateGermlines.py to reconstruct the germline V(D)J sequence, from which the Ig lineage and mutations can be inferred. Parameters ---------- self : Dandelion, DataFrame, str `Dandelion` object, pandas `DataFrame` in changeo/airr format, or file path to changeo/airr file after clones have been determined. germline : str, optional path to germline database folder. Defaults to `$GERMLINE` environmental variable. org : str organism of germline database. Default is 'human'. seq_field : str name of column containing the aligned sequence. Default is 'sequence_alignment' (airr). v_field : str name of column containing the germline V segment call. Default is 'v_call' (airr). d_field : str name of column containing the germline d segment call. Default is 'd_call' (airr). j_field : str name of column containing the germline j segment call. Default is 'j_call' (airr). germ_types : str Specify type(s) of germlines to include full germline, germline with D segment masked, or germline for V segment only. Default is 'dmask'. fileformat : str format of V(D)J file/objects. Default is 'airr'. Also accepts 'changeo'. Returns ------- V(D)J data file with reconstructed germline sequences. """ start = logg.info('Reconstructing germline sequences') env = os.environ.copy() if germline is None: try: gml = env['GERMLINE'] except: raise OSError('Environmental variable GERMLINE must be set. Otherwise, please provide path to folder containing germline fasta files.') gml = gml+'imgt/'+org+'/vdj/' else: if os.path.isdir(germline): env['GERMLINE'] = germline gml = germline def _parseChangeO(record): """ Parses a dictionary to a Receptor object Arguments: record : dict with fields and values in the Change-O format Returns: changeo.Receptor.Receptor : parsed Receptor object. """ # Parse fields result = {} for k, v in record.items(): k = ChangeoSchema.toReceptor(k) result[k] = v return Receptor(result) def _parseAIRR(record): """ Parses a dictionary of AIRR records to a Receptor object Arguments: record : dict with fields and values in the AIRR format. Returns: changeo.Receptor.Receptor : parsed Receptor object. """ # Parse fields result = {} for k, v in record.items(): # Rename fields k = AIRRSchema.toReceptor(k) # Convert start positions to 0-based # if k in ReceptorData.start_fields and v is not None and v != '': # v = str(int(v) + 1) # Assign new field result[k] = v for end, (start, length) in ReceptorData.end_fields.items(): if end in result and result[end] is not None: try: result[length] = int(result[end]) - int(result[start]) + 1 except: pass return Receptor(result) def _create_germlines_object(self, references, seq_field, v_field, d_field, j_field, germ_types, fileformat): """ Write germline sequences to tab-delimited database file Arguments: self : dandelion_class object references : folders and/or files containing germline repertoire data in FASTA format. seq_field : field in which to look for sequence. v_field : field in which to look for V call. d_field : field in which to look for D call. j_field : field in which to look for J call. # cloned : if True build germlines by clone, otherwise build individual germlines. # clone_field : field containing clone identifiers; ignored if cloned=False. germ_types : list of germline sequence types to be output from the set of 'full', 'dmask', 'vonly', 'regions' fileformat : str format of V(D)J file/objects. Default is 'airr'. Also accepts 'changeo'. Returns: """ # Define format operators try: reader, writer, schema = getFormatOperators(fileformat) except: raise ValueError('Invalid format %s' % fileformat) # Define output germline fields germline_fields = OrderedDict() seq_type = seq_field.split('_')[-1] if 'full' in germ_types: germline_fields['full'] = 'germline_' + seq_type if 'dmask' in germ_types: germline_fields['dmask'] = 'germline_' + seq_type + '_d_mask' if 'vonly' in germ_types: germline_fields['vonly'] = 'germline_' + seq_type + '_v_region' if 'regions' in germ_types: germline_fields['regions'] = 'germline_regions' if type(references) is dict: reference_dict = references else: if type(references) is not list: ref = [references] else: ref = references reference_dict = readGermlines(ref) # Check for IMGT-gaps in germlines if all('...' not in x for x in reference_dict.values()): warnings.warn(UserWarning('Germline reference sequences do not appear to contain IMGT-numbering spacers. Results may be incorrect.')) required = ['v_germ_start_imgt', 'd_germ_start', 'j_germ_start', 'np1_length', 'np2_length'] if self.__class__ == Dandelion: if isinstance(self.data, pd.DataFrame): # Check for required columns try: checkFields(required, self.data.columns, schema=schema) except LookupError as e: print(e) # Count input total_count = len(self.data) # Check for existence of fields for f in [v_field, d_field, j_field, seq_field]: if f not in self.data.columns: raise NameError('%s field does not exist in input database file.' % f) # Translate to Receptor attribute names v_field_ = schema.toReceptor(v_field) d_field_ = schema.toReceptor(d_field) j_field_ = schema.toReceptor(j_field) seq_field_ = schema.toReceptor(seq_field) # clone_field = schema.toReceptor(clone_field) # Define Receptor iterator receptor_iter = ((self.data.loc[x, ].sequence_id, self.data.loc[x, ]) for x in self.data.index) else: raise LookupError('Please initialise the Dandelion object with a dataframe in data slot.') elif self.__class__ == pd.DataFrame: try: checkFields(required, self.columns, schema=schema) except LookupError as e: print(e) # Count input total_count = len(self) # Check for existence of fields for f in [v_field, d_field, j_field, seq_field]: if f not in self.columns: raise NameError('%s field does not exist in input database file.' % f) # Translate to Receptor attribute names v_field_ = schema.toReceptor(v_field) d_field_ = schema.toReceptor(d_field) j_field_ = schema.toReceptor(j_field) seq_field_ = schema.toReceptor(seq_field) # clone_field = schema.toReceptor(clone_field) # Define Receptor iterator receptor_iter = ((self.loc[x, ].sequence_id, self.loc[x, ]) for x in self.index) out = {} # Iterate over rows for key, records in tqdm(receptor_iter, desc = " Building {} germline sequences".format(germ_types)): # Define iteration variables # Build germline for records if fileformat == 'airr': germ_log, glines, genes = buildGermline(_parseAIRR(dict(records)), reference_dict, seq_field=seq_field_, v_field=v_field_, d_field=d_field_, j_field=j_field_) elif fileformat == 'changeo': germ_log, glines, genes = buildGermline(_parseChangeO(dict(records)), reference_dict, seq_field=seq_field_, v_field=v_field_, d_field=d_field_, j_field=j_field_) else: raise AttributeError('%s is not acceptable file format.' % fileformat) if glines is not None: # Add glines to Receptor record annotations = {} if 'full' in germ_types: annotations[germline_fields['full']] = glines['full'] if 'dmask' in germ_types: annotations[germline_fields['dmask']] = glines['dmask'] if 'vonly' in germ_types: annotations[germline_fields['vonly']] = glines['vonly'] if 'regions' in germ_types: annotations[germline_fields['regions']] = glines['regions'] out.update({key:annotations}) germline_df = pd.DataFrame.from_dict(out, orient = 'index') if self.__class__ == Dandelion: # datx = load_data(self.data) for x in germline_df.columns: self.data[x] = pd.Series(germline_df[x]) elif self.__class__ == pd.DataFrame: datx = load_data(self) for x in germline_df.columns: datx[x] = pd.Series(germline_df[x]) try: output = Dandelion(data = datx, germline = reference_dict, initialize = True) except: output = Dandelion(data = datx, germline = reference_dict, initialize = False) return(output) sleep(0.5) logg.info(' finished', time=start, deep=('Updated Dandelion object: \n' ' \'data\', updated germline alignment in contig-indexed clone table\n' ' \'germline\', updated germline reference\n')) def _create_germlines_file(file, references, seq_field, v_field, d_field, j_field, germ_types, fileformat): """ Write germline sequences to tab-delimited database file Arguments: file : airr/changeo tsv file references : folders and/or files containing germline repertoire data in FASTA format. seq_field : field in which to look for sequence. v_field : field in which to look for V call. d_field : field in which to look for D call. j_field : field in which to look for J call. cloned : if True build germlines by clone, otherwise build individual germlines. germ_types : list of germline sequence types to be output from the set of 'full', 'dmask', 'vonly', 'regions' fileformat : str format of V(D)J file/objects. Default is 'airr'. Also accepts 'changeo'. Returns: """ # Define format operators try: reader, writer, schema = getFormatOperators(fileformat) except: raise ValueError('Invalid format %s' % fileformat) # Define output germline fields germline_fields = OrderedDict() seq_type = seq_field.split('_')[-1] if 'full' in germ_types: germline_fields['full'] = 'germline_' + seq_type if 'dmask' in germ_types: germline_fields['dmask'] = 'germline_' + seq_type + '_d_mask' if 'vonly' in germ_types: germline_fields['vonly'] = 'germline_' + seq_type + '_v_region' if 'regions' in germ_types: germline_fields['regions'] = 'germline_regions' if type(references) is dict: reference_dict = references else: if type(references) is not list: ref = [references] else: ref = references reference_dict = readGermlines(ref) # Check for IMGT-gaps in germlines if all('...' not in x for x in reference_dict.values()): warnings.warn(UserWarning('Germline reference sequences do not appear to contain IMGT-numbering spacers. Results may be incorrect.')) required = ['v_germ_start_imgt', 'd_germ_start', 'j_germ_start', 'np1_length', 'np2_length'] # Get repertoire and open Db reader db_handle = open(file, 'rt') db_iter = reader(db_handle) # Check for required columns try: checkFields(required, db_iter.fields, schema=schema) except LookupError as e: print(e) # Count input total_count = countDbFile(file) # Check for existence of fields for f in [v_field, d_field, j_field, seq_field]: if f not in db_iter.fields: raise NameError('%s field does not exist in input database file.' % f) # Translate to Receptor attribute names v_field_ = schema.toReceptor(v_field) d_field_ = schema.toReceptor(d_field) j_field_ = schema.toReceptor(j_field) seq_field_ = schema.toReceptor(seq_field) # clone_field = schema.toReceptor(clone_field) # Define Receptor iterator receptor_iter = ((x.sequence_id, [x]) for x in db_iter) out = {} # Iterate over rows for key, records in tqdm(receptor_iter, desc = " Building {} germline sequences".format(germ_types)): # Define iteration variables # Build germline for records # if not isinstance(self.data, pd.DataFrame): records = list(records) germ_log, glines, genes = buildGermline(records[0], reference_dict, seq_field=seq_field_, v_field=v_field_, d_field=d_field_, j_field=j_field_) if glines is not None: # Add glines to Receptor record annotations = {} if 'full' in germ_types: annotations[germline_fields['full']] = glines['full'] if 'dmask' in germ_types: annotations[germline_fields['dmask']] = glines['dmask'] if 'vonly' in germ_types: annotations[germline_fields['vonly']] = glines['vonly'] if 'regions' in germ_types: annotations[germline_fields['regions']] = glines['regions'] out.update({key:annotations}) germline_df = pd.DataFrame.from_dict(out, orient = 'index') try: out = Dandelion(data = file, germline = reference_dict, initialize = True) except: out = Dandelion(data = file, germline = reference_dict, initialize = False) for x in germline_df.columns: out.data[x] = pd.Series(germline_df[x]) if os.path.isfile(str(file)): out.data.to_csv("{}/{}_germline_{}.tsv".format(os.path.dirname(file), os.path.basename(file).split('.tsv')[0], germ_types), sep = '\t', index = False) return(out) if (type(germline) is dict) or (type(germline) is list): if self.__class__ == Dandelion: _create_germlines_object(self, germline, seq_field, v_field, d_field, j_field, germ_types, fileformat) elif self.__class__ == pd.DataFrame: return(_create_germlines_object(self, germline, seq_field, v_field, d_field, j_field, germ_types, fileformat)) else: return(_create_germlines_file(self, germline, seq_field, v_field, d_field, j_field, germ_types, fileformat)) else: if self.__class__ == Dandelion: if len(self.germline) is not 0: _create_germlines_object(self, self.germline, seq_field, v_field, d_field, j_field, germ_types, fileformat) else: _create_germlines_object(self, gml, seq_field, v_field, d_field, j_field, germ_types, fileformat) elif self.__class__ == pd.DataFrame: return(_create_germlines_object(self, gml, seq_field, v_field, d_field, j_field, germ_types, fileformat)) else: return(_create_germlines_file(self, gml, seq_field, v_field, d_field, j_field, germ_types, fileformat))
[docs]def filter_bcr(data, adata, filter_bcr=True, filter_rna=True, filter_poorqualitybcr=False, rescue_igh=True, umi_foldchange_cutoff=2, filter_lightchains=True, filter_missing=True, parallel = True, ncpu = None, save=None): """ Filters doublets and poor quality cells and corresponding contigs based on provided V(D)J `DataFrame` and `AnnData` objects. Depends on a `AnnData`.obs slot populated with 'filter_rna' column. If the aligned sequence is an exact match between contigs, the contigs will be merged into the one with the highest umi count, adding the summing the umi count of the duplicated contigs to duplicate_count column. After this check, if there are still multiple contigs, cells with multiple IGH contigs are filtered unless `rescue_igh` is True, where by the umi counts for each IGH contig will then be compared. The contig with the highest umi that is > umi_foldchange_cutoff (default is empirically set at 5) from the lowest will be retained. If there's multiple contigs that survive the 'rescue', then all contigs will be filtered. The default behaviour is to also filter cells with multiple lightchains but this may sometimes be a true biological occurrence; toggling filter_lightchains to False will rescue the mutltiplet light chains. Lastly, contigs with no corresponding cell barcode in the AnnData object is filtered if filter_missing is True. However, this may be useful to toggle to False if more contigs are preferred to be kept or for integrating with bulk reperotire seq data. Parameters ---------- data : DataDrame, str V(D)J airr/changeo data to filter. Can be pandas `DataFrame` object or file path as string. adata : AnnData AnnData object to filter. filter_bcr : bool If True, V(D)J `DataFrame` object returned will be filtered. Default is True. filter_rna : bool If True, `AnnData` object returned will be filtered. Default is True. filter_poorqualitybcr : bool If True, barcodes marked with poor quality BCR contigs will be filtered. Default is False; only relevant contigs are removed and RNA barcodes are kept. rescue_igh : bool If True, rescues IGH contigs with highest umi counts with a requirement that it passes the `umi_foldchange_cutoff` option. In addition, the sum of the all the heavy chain contigs must be greater than 3 umi or all contigs will be filtered. Default is True. umi_foldchange_cutoff : int related to minimum fold change required to rescue heavy chain contigs/barcode otherwise they will be marked as doublets. Default is empirically set at 2-fold. filter_lightchains : bool cells with multiple light chains will be marked to filter. Default is True. filter_missing : bool cells in V(D)J data not found in `AnnData` object will be marked to filter. Default is True. This may be useful for toggling to False if integrating with bulk data. parallel : bool whether or not to use parallelization. Default is True. ncpu : int number of cores to use if parallel is True. Default is all available - 1. save : str, optional Only used if a pandas dataframe or dandelion object is provided. Specifying will save the formatted vdj table. Returns ------- V(D)J `DataFrame` object in airr/changeo format and `AnnData` object. """ start = logg.info('Filtering BCRs') if data.__class__ == Dandelion: dat = load_data(data.data) else: dat = load_data(data) h = Tree() l = Tree() h_umi = Tree() h_dup = Tree() l_umi = Tree() # l_dup = Tree() h_seq = Tree() l_seq = Tree() h_ccall = Tree() # l_ccall = Tree() locus_dict = dict(zip(dat['sequence_id'],dat['locus'])) if 'cell_id' not in dat.columns: raise AttributeError("VDJ data does not contain 'cell_id' column. Please make sure this is populated before filtering.") if 'filter_rna' not in adata.obs: raise AttributeError("AnnData obs does not contain 'filter_rna' column. Please run `pp.recipe_scanpy_qc` before continuing.") barcode = list(set(dat['cell_id'])) bcr_check = pd.DataFrame(index = adata.obs_names) bc_ = {} for b in barcode: bc_.update({b:True}) bcr_check['has_bcr'] = pd.Series(bc_) bcr_check.replace(np.nan, False, inplace = True) adata.obs['has_bcr'] = pd.Series(bcr_check['has_bcr']) adata.obs['has_bcr'] = adata.obs['has_bcr'].astype('category') if 'v_call_genotyped' in dat.columns: v_dict = dict(zip(dat['sequence_id'], dat['v_call_genotyped'])) else: v_dict = dict(zip(dat['sequence_id'], dat['v_call'])) j_dict = dict(zip(dat['sequence_id'], dat['j_call'])) c_dict = dict(zip(dat['sequence_id'], dat['c_call'])) # rather than leaving a nan cell, i will create a 0 column for now dat['duplicate_count'] = 0 global parallel_marking def parallel_marking(b): poor_qual, h_doublet, l_doublet, drop_contig = [], [], [], [] hc_id = list(dat[(dat['cell_id'].isin([b])) & (dat['locus'] == 'IGH')]['sequence_id']) hc_umi = [int(x) for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'] == 'IGH')]['umi_count']] hc_seq = [x for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'] == 'IGH')]['sequence_alignment']] hc_dup = [int(x) for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'] == 'IGH')]['duplicate_count']] hc_ccall = [x for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'] == 'IGH')]['c_call']] lc_id = list(dat[(dat['cell_id'].isin([b])) & (dat['locus'].isin(['IGK', 'IGL']))]['sequence_id']) lc_umi = [int(x) for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'].isin(['IGK', 'IGL']))]['umi_count']] lc_seq = [x for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'].isin(['IGK', 'IGL']))]['sequence_alignment']] # lc_ccall = [x for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'].isin(['IGK', 'IGL']))]['c_call']] h[b] = hc_id h_umi[b] = hc_umi h_seq[b] = hc_seq h_dup[b] = hc_dup h_ccall[b] = hc_ccall l[b] = lc_id l_umi[b] = lc_umi l_seq[b] = lc_seq # l_ccall[b] = lc_ccall # marking doublets defined by heavy chains if len(h[b]) > 1: ccall = [] if len(list(set(h_seq[b]))) == 1: highest_umi_h = max(h_umi[b]) highest_umi_h_idx = [i for i, j in enumerate(h_umi[b]) if j == highest_umi_h] keep_index_h = highest_umi_h_idx[0] drop_contig.append(h[b][:keep_index_h] + h[b][keep_index_h+1 :]) keep_hc_contig = h[b][keep_index_h] dat.at[keep_hc_contig, 'duplicate_count'] = int(np.sum(h_umi[b][:keep_index_h] + h_umi[b][keep_index_h+1 :])) hc_id = list(dat[(dat['cell_id'].isin([b])) & (dat['locus'] == 'IGH')]['sequence_id']) hc_umi = [int(x) for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'] == 'IGH')]['umi_count']] hc_dup = [int(x) for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'] == 'IGH')]['duplicate_count']] h[b] = hc_id h_umi[b] = hc_umi h_dup[b] = hc_dup h_seq[b] = hc_seq if len(h[b]) > 1: if rescue_igh: highest_umi_h = max(h_umi[b]) lowest_umi_h = min(h_umi[b]) highest_umi_idx = [i for i, j in enumerate(h_umi[b]) if j == highest_umi_h] keep_index_h = highest_umi_idx[0] umi_test = [highest_umi_h/x < umi_foldchange_cutoff for x in h_umi[b][:keep_index_h] + h_umi[b][keep_index_h+1 :]] sum_umi = sum(h_umi[b]+h_dup[b]) if len(highest_umi_idx) > 1: h_doublet.append(b) if sum_umi < 4: h_doublet.append(b) if any(umi_test): h_doublet.append(b) if len(highest_umi_idx) == 1: other_umi_idx = [i for i, j in enumerate(h_umi[b]) if j != highest_umi_h] umi_test_ = [highest_umi_h/x >= umi_foldchange_cutoff for x in h_umi[b][:keep_index_h] + h_umi[b][keep_index_h+1 :]] umi_test_dict = dict(zip(other_umi_idx, umi_test_)) for otherindex in umi_test_dict: if umi_test_dict[otherindex]: drop_contig.append(h[b][otherindex]) ccall.append(h_ccall[b][otherindex]) if len(ccall) == 1: # experimental: see if this can pick up any naive IgM+IgD+ cells? try: call_list = list(h_ccall[b][keep_index_h])+ccall if call_list == ['IGHM', 'IGHD'] or call_list == ['IGHD', 'IGHM']: dat.at[keep_hc_contig, 'c_call'] = 'IGHM|IGHD' except: pass else: h_doublet.append(b) if len(l[b]) > 1: if len(list(set(l_seq[b]))) == 1: highest_umi_l = max(l_umi[b]) highest_umi_l_idx = [i for i, j in enumerate(l_umi[b]) if j == highest_umi_l] keep_index_l = highest_umi_l_idx[0] drop_contig.append(l[b][:keep_index_l] + l[b][keep_index_l+1 :]) keep_lc_contig = l[b][keep_index_l] dat.at[keep_lc_contig, 'duplicate_count'] = int(np.sum(l_umi[b][:keep_index_l] + l_umi[b][keep_index_l+1 :])) lc_id = list(dat[(dat['cell_id'].isin([b])) & (dat['locus'].isin(['IGK', 'IGL']))]['sequence_id']) lc_umi = [int(x) for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'].isin(['IGK', 'IGL']))]['umi_count']] l[b] = lc_id l_umi[b] = lc_umi l_seq[b] = lc_seq if len(list(set(l_seq[b]))) > 1: # also apply the same cut off to multiple light chains highest_umi_l = max(l_umi[b]) highest_umi_l_idx = [i for i, j in enumerate(l_umi[b]) if j == highest_umi_l] keep_index_l = highest_umi_l_idx[0] other_umi_idx_l = [i for i, j in enumerate(l_umi[b]) if j != highest_umi_l] umi_test_l = [highest_umi_l/x < umi_foldchange_cutoff for x in l_umi[b][:keep_index_l] + l_umi[b][keep_index_l+1 :]] umi_test_dict_l = dict(zip(other_umi_idx_l, umi_test_l)) for otherindex in umi_test_dict_l: if umi_test_dict_l[otherindex]: drop_contig.append(l[b][otherindex]) # marking doublets defined by light chains if (len(h[b]) == 1) & (len(l[b]) > 1): l_doublet.append(b) # marking poor bcr quality, defined as those with only light chains, those # that were have conflicting assignment of locus and heavy/light V/J calls, # and also those that are missing either v or j calls. if len(h[b]) < 1: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(l[b]) if len(hc_id) == 1: v = v_dict[hc_id[0]] j = j_dict[hc_id[0]] c = c_dict[hc_id[0]] if v is not np.nan: if 'IGH' not in v: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(l[b]) drop_contig.append(h[b]) if j is not np.nan: if 'IGH' not in j: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(l[b]) drop_contig.append(h[b]) if c is not np.nan and c is not None: if 'IGH' not in c: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(l[b]) drop_contig.append(h[b]) if len(hc_id) > 1: for hx in hc_id: v = v_dict[hx] j = j_dict[hx] c = c_dict[hx] if v is not np.nan: if 'IGH' not in v: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(hx) if j is not np.nan: if 'IGH' not in j: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(hx) if c is not np.nan and c is not None: if 'IGH' not in c: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(hx) if len(lc_id) > 0: for lx in lc_id: v = v_dict[lx] j = j_dict[lx] c = c_dict[lx] if v is not np.nan: if j is not np.nan: if 'IGH' in v: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(lx) elif 'IGK' in v: if 'IGL' in j: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(lx) if j is not np.nan: if v is not np.nan: if 'IGH' in j: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(lx) elif 'IGL' in v: if 'IGK' in v: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(lx) if c is not None and c is not np.nan: if 'IGH' in c: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(lx) if v == np.nan or j == np.nan or v == None or j == None: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(lx) # no/wrong annotations at all poor_qual_, h_doublet_, l_doublet_, drop_contig_ = poor_qual, h_doublet, l_doublet, drop_contig return(poor_qual_, h_doublet_, l_doublet_, drop_contig_) if parallel: poor_qual, h_doublet, l_doublet, drop_contig = [], [], [], [] if ncpu is None: ncpus = multiprocessing.cpu_count()-1 else: ncpus = int(ncpu) print('Scanning for poor quality/ambiguous contigs with {} cpus'.format(ncpus)) with multiprocessing.Pool(ncpus) as p: result = p.map(parallel_marking, iter(barcode)) pq, hd, ld ,dc = [], [], [], [] for r in result: pq = pq + r[0] hd = hd + r[1] ld = ld + r[2] dc = dc + r[3] poor_qual, h_doublet, l_doublet, drop_contig = pq, hd, ld, dc else: poor_qual, h_doublet, l_doublet, drop_contig = [], [], [], [] for b in tqdm(barcode, desc = 'Scanning for poor quality/ambiguous contigs'): hc_id = list(dat[(dat['cell_id'].isin([b])) & (dat['locus'] == 'IGH')]['sequence_id']) hc_umi = [int(x) for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'] == 'IGH')]['umi_count']] hc_seq = [x for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'] == 'IGH')]['sequence_alignment']] hc_dup = [int(x) for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'] == 'IGH')]['duplicate_count']] hc_ccall = [x for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'] == 'IGH')]['c_call']] lc_id = list(dat[(dat['cell_id'].isin([b])) & (dat['locus'].isin(['IGK', 'IGL']))]['sequence_id']) lc_umi = [int(x) for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'].isin(['IGK', 'IGL']))]['umi_count']] lc_seq = [x for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'].isin(['IGK', 'IGL']))]['sequence_alignment']] # lc_ccall = [x for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'].isin(['IGK', 'IGL']))]['c_call']] h[b] = hc_id h_umi[b] = hc_umi h_seq[b] = hc_seq h_dup[b] = hc_dup h_ccall[b] = hc_ccall l[b] = lc_id l_umi[b] = lc_umi l_seq[b] = lc_seq # l_ccall[b] = lc_ccall # l_dup[b] = lc_dup # marking doublets defined by heavy chains if len(h[b]) > 1: ccall = [] if len(list(set(h_seq[b]))) == 1: highest_umi_h = max(h_umi[b]) highest_umi_h_idx = [i for i, j in enumerate(h_umi[b]) if j == highest_umi_h] keep_index_h = highest_umi_h_idx[0] drop_contig.append(h[b][:keep_index_h] + h[b][keep_index_h+1 :]) keep_hc_contig = h[b][keep_index_h] dat.at[keep_hc_contig, 'duplicate_count'] = int(np.sum(h_umi[b][:keep_index_h] + h_umi[b][keep_index_h+1 :])) hc_id = list(dat[(dat['cell_id'].isin([b])) & (dat['locus'] == 'IGH')]['sequence_id']) hc_umi = [int(x) for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'] == 'IGH')]['umi_count']] hc_dup = [int(x) for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'] == 'IGH')]['duplicate_count']] h[b] = hc_id h_umi[b] = hc_umi h_dup[b] = hc_dup h_seq[b] = hc_seq if len(h[b]) > 1: if rescue_igh: highest_umi_h = max(h_umi[b]) lowest_umi_h = min(h_umi[b]) highest_umi_idx = [i for i, j in enumerate(h_umi[b]) if j == highest_umi_h] keep_index_h = highest_umi_idx[0] umi_test = [highest_umi_h/x < umi_foldchange_cutoff for x in h_umi[b][:keep_index_h] + h_umi[b][keep_index_h+1 :]] sum_umi = sum(h_umi[b]+h_dup[b]) if len(highest_umi_idx) > 1: h_doublet.append(b) if sum_umi < 4: h_doublet.append(b) if any(umi_test): h_doublet.append(b) if len(highest_umi_idx) == 1: other_umi_idx = [i for i, j in enumerate(h_umi[b]) if j != highest_umi_h] umi_test_ = [highest_umi_h/x >= umi_foldchange_cutoff for x in h_umi[b][:keep_index_h] + h_umi[b][keep_index_h+1 :]] umi_test_dict = dict(zip(other_umi_idx, umi_test_)) for otherindex in umi_test_dict: if umi_test_dict[otherindex]: drop_contig.append(h[b][otherindex]) ccall.append(h_ccall[b][otherindex]) if len(ccall) == 1: # experimental: see if this can pick up any naive IgM+IgD+ cells? try: call_list = list(h_ccall[b][keep_index_h])+ccall if call_list == ['IGHM', 'IGHD'] or call_list == ['IGHD', 'IGHM']: dat.at[keep_hc_contig, 'c_call'] = 'IGHM|IGHD' except: pass else: h_doublet.append(b) if len(l[b]) > 1: if len(list(set(l_seq[b]))) == 1: highest_umi_l = max(l_umi[b]) highest_umi_l_idx = [i for i, j in enumerate(l_umi[b]) if j == highest_umi_l] keep_index_l = highest_umi_l_idx[0] drop_contig.append(l[b][:keep_index_l] + l[b][keep_index_l+1 :]) keep_lc_contig = l[b][keep_index_l] dat.at[keep_lc_contig, 'duplicate_count'] = int(np.sum(l_umi[b][:keep_index_l] + l_umi[b][keep_index_l+1 :])) lc_id = list(dat[(dat['cell_id'].isin([b])) & (dat['locus'].isin(['IGK', 'IGL']))]['sequence_id']) lc_umi = [int(x) for x in dat[(dat['cell_id'].isin([b])) & (dat['locus'].isin(['IGK', 'IGL']))]['umi_count']] l[b] = lc_id l_umi[b] = lc_umi l_seq[b] = lc_seq if len(list(set(l_seq[b]))) > 1: # also apply the same cut off to multiple light chains highest_umi_l = max(l_umi[b]) highest_umi_l_idx = [i for i, j in enumerate(l_umi[b]) if j == highest_umi_l] keep_index_l = highest_umi_l_idx[0] other_umi_idx_l = [i for i, j in enumerate(l_umi[b]) if j != highest_umi_l] umi_test_l = [highest_umi_l/x < umi_foldchange_cutoff for x in l_umi[b][:keep_index_l] + l_umi[b][keep_index_l+1 :]] umi_test_dict_l = dict(zip(other_umi_idx_l, umi_test_l)) for otherindex in umi_test_dict_l: if umi_test_dict_l[otherindex]: drop_contig.append(l[b][otherindex]) # marking doublets defined by light chains if (len(h[b]) == 1) & (len(l[b]) > 1): l_doublet.append(b) # marking poor bcr quality, defined as those with only light chains, those # that were have conflicting assignment of locus and heavy/light V/J calls, # and also those that are missing either v or j calls. if len(h[b]) < 1: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(l[b]) if len(hc_id) == 1: v = v_dict[hc_id[0]] j = j_dict[hc_id[0]] c = c_dict[hc_id[0]] if v is not np.nan: if 'IGH' not in v: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(l[b]) drop_contig.append(h[b]) if j is not np.nan: if 'IGH' not in j: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(l[b]) drop_contig.append(h[b]) if c is not np.nan and c is not None: if 'IGH' not in c: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(l[b]) drop_contig.append(h[b]) if len(hc_id) > 1: for hx in hc_id: v = v_dict[hx] j = j_dict[hx] c = c_dict[hx] if v is not np.nan: if 'IGH' not in v: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(hx) if j is not np.nan: if 'IGH' not in j: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(hx) if c is not np.nan and c is not None: if 'IGH' not in c: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(hx) if len(lc_id) > 0: for lx in lc_id: v = v_dict[lx] j = j_dict[lx] c = c_dict[lx] if 'IGH' in v: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(lx) elif 'IGK' in v: if 'IGL' in j: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(lx) if 'IGH' in j: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(lx) elif 'IGL' in v: if 'IGK' in v: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(lx) if c is not None and c is not np.nan: if 'IGH' in c: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(lx) if v == np.nan or j == np.nan or v == None or j == None: if filter_poorqualitybcr: poor_qual.append(b) drop_contig.append(lx) # no/wrong annotations at all poorqual = Tree() hdoublet = Tree() ldoublet = Tree() for c in tqdm(adata.obs_names, desc = 'Annotating in anndata obs slot '): if c in poor_qual: poorqual[c] = True else: poorqual[c] = False if c in h_doublet: hdoublet[c] = True else: hdoublet[c] = False if c in l_doublet: ldoublet[c] = True else: ldoublet[c] = False adata.obs['filter_bcr_quality'] = pd.Series(dict(poorqual)) adata.obs['filter_bcr_quality'] = adata.obs['filter_bcr_quality'].astype('category') adata.obs['filter_bcr_heavy'] = pd.Series(dict(hdoublet)) adata.obs['filter_bcr_heavy'] = adata.obs['filter_bcr_heavy'].astype('category') adata.obs['filter_bcr_light'] = pd.Series(dict(ldoublet)) adata.obs['filter_bcr_light'] = adata.obs['filter_bcr_light'].astype('category') drop_contig = list(set(flatten(drop_contig))) filter_ids = [] if filter_bcr: print('Finishing up filtering') if not filter_lightchains: if filter_poorqualitybcr: filter_ids = list(set(h_doublet + poor_qual)) else: filter_ids = list(set(h_doublet)) else: if filter_poorqualitybcr: filter_ids = list(set(h_doublet + l_doublet + poor_qual)) else: filter_ids = list(set(h_doublet + l_doublet)) if filter_rna: filter_ids = filter_ids + list(adata[adata.obs['filter_rna'] == True].obs_names) filter_ids = list(set(filter_ids)) if filter_missing: for c in dat['cell_id']: if c not in adata.obs_names: filter_ids.append(c) _dat = dat[~(dat['cell_id'].isin(filter_ids))] _dat = _dat[~(_dat['sequence_id'].isin(drop_contig))] if _dat.shape[0] is 0: raise IndexError('No BCRs passed filtering. Are you sure that the cell barcodes are matching?') if os.path.isfile(str(data)): _dat.to_csv("{}/{}_filtered.tsv".format(os.path.dirname(data), os.path.basename(data).split('.tsv')[0]), sep = '\t', index = False) else: if save is not None: if save.endswith('.tsv'): _dat.to_csv(str(save), sep = '\t', index = False) else: raise OSError('Please provide a file name that ends with .tsv') else: _dat = dat.copy() barcode2 = list(set(_dat['cell_id'])) bc_2 = {} for b in barcode2: bc_2.update({b:True}) bcr_check['bcr_QC_pass'] = pd.Series(bc_2) bcr_check.replace(np.nan, False, inplace = True) adata.obs['bcr_QC_pass'] = pd.Series(bcr_check['bcr_QC_pass']) adata.obs['bcr_QC_pass'] = adata.obs['bcr_QC_pass'].astype('category') print('Initializing Dandelion object') if data.__class__ == Dandelion: out_dat = Dandelion(data = _dat, germline = data.germline, initialize = True) else: try: out_dat = Dandelion(data = _dat, initialize = True) except: warnings.warn(UserWarning('Dandelion metadata cannot be initialized due to duplicate barcodes. Recommending to run function with filter_bcr = True.')) out_dat = Dandelion(data = _dat, initialize = False) adata.obs['filter_bcr'] = adata.obs_names.isin(filter_ids) adata.obs['filter_bcr'] = adata.obs['filter_bcr'].astype('category') if filter_rna: out_adata = adata[adata.obs['filter_bcr'] == False] # not saving the scanpy object because there's no need to at the moment else: out_adata = adata.copy() logg.info(' finished', time=start, deep=('Returning Dandelion and AnnData objects: \n')) return(out_dat, out_adata)
[docs]def quantify_mutations(self, split_locus = False, region_definition=None, mutation_definition=None, frequency=True, combine=True): """ Runs basic mutation load analysis implemented in `shazam <https://shazam.readthedocs.io/en/stable/vignettes/Mutation-Vignette/>`__. Parameters ---------- self : Dandelion `Dandelion` object split_locus : bool whether to return the results for heavy chain and light chain separately. Default is False. region_definition : str, optional passed to shazam's `observedMutations <https://shazam.readthedocs.io/en/stable/topics/observedMutations/>`__. mutation_definition : str, optional passed to shazam's `observedMutations <https://shazam.readthedocs.io/en/stable/topics/observedMutations/>`__. frequency whether to return the results a frequency or counts. Default is True (frequency). combine whether to return the results for replacement and silent mutations separately (False). Default is True (sum). Returns ------- `Dandelion` object with updated `.metadata` slot. """ start = logg.info('Quantifying mutations') try: from rpy2.robjects.packages import importr, data from rpy2.rinterface import NULL from rpy2.robjects import pandas2ri, StrVector, FloatVector except: raise(ImportError("Unable to initialise R instance. Please run this separately through R with Shazam's tutorial.")) sh = importr('shazam') if self.__class__ == Dandelion: dat = load_data(self.data) elif self.__class__ == pd.DataFrame or os.path.isfile(self): dat = load_data(self) else: raise ValueError("{} object/file not found.".format(self)) pandas2ri.activate() warnings.filterwarnings("ignore") if region_definition is None: reg_d = NULL else: reg_d = data(sh).fetch(region_definition) if mutation_definition is None: mut_d = NULL else: mut_d = data(sh).fetch(mutation_definition) if split_locus is False: dat = dat.where(dat.isna(), dat.astype(str)) try: dat_r = pandas2ri.py2rpy(dat) except: dat = dat.astype(str) dat_r = pandas2ri.py2rpy(dat) results = sh.observedMutations(dat_r, sequenceColumn = "sequence_alignment", germlineColumn = "germline_alignment_d_mask", regionDefinition = reg_d, mutationDefinition = mut_d, frequency = frequency, combine = combine) # pd_df = pandas2ri.rpy2py_dataframe(results) pd_df = results.copy() else: dat_h = dat[dat['locus'] == 'IGH'] dat_l = dat[dat['locus'].isin(['IGK', 'IGL'])] dat_h = dat_h.where(dat_h.isna(), dat_h.astype(str)) try: dat_h_r = pandas2ri.py2rpy(dat_h) except: dat_h = dat_h.astype(str) dat_h_r = pandas2ri.py2rpy(dat_h) dat_l = dat_l.where(dat_l.isna(), dat_l.astype(str)) try: dat_l_r = pandas2ri.py2rpy(dat_l) except: dat_l = dat_l.astype(str) dat_l_r = pandas2ri.py2rpy(dat_l) results_h = sh.observedMutations(dat_h_r, sequenceColumn = "sequence_alignment", germlineColumn = "germline_alignment_d_mask", regionDefinition = reg_d, mutationDefinition = mut_d, frequency = frequency, combine = combine) results_l = sh.observedMutations(dat_l_r, sequenceColumn = "sequence_alignment", germlineColumn = "germline_alignment_d_mask", regionDefinition = reg_d, mutationDefinition = mut_d, frequency = frequency, combine = combine) pd_df = pd.concat([results_h, results_l]) pd_df.set_index('sequence_id', inplace = True, drop = False) cols_to_return = pd_df.columns.difference(dat.columns) # this doesn't actually catch overwritten columns if len(cols_to_return) < 1: cols_to_return = list(filter(re.compile("mu_.*").match, [c for c in pd_df.columns])) else: cols_to_return = cols_to_return res = {} if self.__class__ == Dandelion: for x in cols_to_return: res[x] = list(pd_df[x]) self.data[x] = [str(r) for r in res[x]] # TODO: str will make it work for the back and forth conversion with rpy2. but maybe can use a better option? if split_locus is False: metadata_ = self.data[['cell_id']+list(cols_to_return)] else: metadata_ = self.data[['locus', 'cell_id']+list(cols_to_return)] for x in cols_to_return: metadata_[x] = metadata_[x].astype(np.float32) if split_locus is False: metadata_ = metadata_.groupby('cell_id').sum() else: metadata_ = metadata_.groupby(['locus','cell_id']).sum() metadatas = [] for x in list(set(self.data['locus'])): tmp = metadata_.iloc[metadata_.index.isin([x], level='locus'),:] tmp.index = tmp.index.droplevel() tmp.columns = [c+'_'+str(x) for c in tmp.columns] metadatas.append(tmp) metadata_ = functools.reduce(lambda x, y: pd.merge(x, y, left_index = True, right_index = True, how = 'outer'), metadatas) metadata_.index.name = None if self.metadata is None: self.metadata = metadata_ else: for x in metadata_.columns: self.metadata[x] = pd.Series(metadata_[x]) logg.info(' finished', time=start, deep=('Updated Dandelion object: \n' ' \'data\', contig-indexed clone table\n' ' \'metadata\', cell-indexed clone table\n')) else: for x in cols_to_return: res[x] = list(pd_df[x]) dat[x] = [str(r) for r in res[x]] # TODO: str will make it work for the back and forth conversion with rpy2. but maybe can use a better option? if self.__class__ == pd.DataFrame: logg.info(' finished', time=start, deep=('Returning DataFrame\n')) return(dat) elif os.path.isfile(self): logg.info(' finished', time=start, deep=('saving DataFrame at {}\n'.format(str(self)))) dat.to_csv(self, sep = '\t', index=False)
[docs]def calculate_threshold(self, manual_threshold=None, model=None, normalize_method=None, threshold_method=None, edge=None, cross=None, subsample=None, threshold_model=None, cutoff=None, sensitivity=None, specificity=None, ncpu=None, plot=True, plot_group=None, figsize=(4.5, 2.5), *args): """ Calculating nearest neighbor distances for tuning clonal assignment with `shazam <https://shazam.readthedocs.io/en/stable/vignettes/DistToNearest-Vignette/>`__. Runs the following: distToNearest Get non-zero distance of every heavy chain (IGH) sequence (as defined by sequenceColumn) to its nearest sequence in a partition of heavy chains sharing the same V gene, J gene, and junction length (VJL), or in a partition of single cells with heavy chains sharing the same heavy chain VJL combination, or of single cells with heavy and light chains sharing the same heavy chain VJL and light chain VJL combinations. findThreshold automtically determines an optimal threshold for clonal assignment of Ig sequences using a vector of nearest neighbor distances. It provides two alternative methods using either a Gamma/Gaussian Mixture Model fit (threshold_method="gmm") or kernel density fit (threshold_method="density"). Parameters ---------- self : Dandelion, DataFrame, str `Dandelion` object, pandas `DataFrame` in changeo/airr format, or file path to changeo/airr file after clones have been determined. manual_threshold : float, optional value to manually plot in histogram. model : str, optional underlying SHM model, which must be one of c("ham", "aa", "hh_s1f", "hh_s5f", "mk_rs1nf", "hs1f_compat", "m1n_compat"). normalize_method : str, optional method of normalization. The default is "len", which divides the distance by the length of the sequence group. If "none" then no normalization if performed. threshold_method : str, optional string defining the method to use for determining the optimal threshold. One of "gmm" or "density". edge : float, optional upper range as a fraction of the data density to rule initialization of Gaussian fit parameters. Default value is 0.9 (or 90). Applies only when threshold_method="density". cross : list, array, optional supplementary nearest neighbor distance vector output from distToNearest for initialization of the Gaussian fit parameters. Applies only when method="gmm". subsample : int, optional maximum number of distances to subsample to before threshold detection. threshold_model : str, optional allows the user to choose among four possible combinations of fitting curves: "norm-norm", "norm-gamma", "gamma-norm", and "gamma-gamma". Applies only when method="gmm". cutoff : str, optional method to use for threshold selection: the optimal threshold "opt", the intersection point of the two fitted curves "intersect", or a value defined by user for one of the sensitivity or specificity "user". Applies only when method="gmm". sensitivity : float, optional sensitivity required. Applies only when method="gmm" and cutoff="user". specificity : float, optional specificity required. Applies only when method="gmm" and cutoff="user". ncpu : int, optional number of cpus for parallelization. Default is all available cpus. plot : bool whether or not to return plot. plot_group : str, optional determines the fill color and facets. figsize : tuple[float, float] size of plot. Default is (4.5, 2.5). *args passed to shazam's `distToNearest <https://shazam.readthedocs.io/en/stable/topics/distToNearest/>`__. Returns ------- plotnine plot showing histogram of length normalized ham model distance threshold. """ start = logg.info('Calculating threshold') try: from rpy2.robjects.packages import importr, data from rpy2.rinterface import NULL from rpy2.robjects import pandas2ri, StrVector, FloatVector except: raise(ImportError("Unable to initialise R instance. Please run this separately through R with Shazam's tutorial.")) if self.__class__ == Dandelion: dat = load_data(self.data) elif self.__class__ == pd.DataFrame or os.path.isfile(str(self)): dat = load_data(self) warnings.filterwarnings("ignore") sh = importr('shazam') pandas2ri.activate() if 'v_call_genotyped' in dat.columns: v_call = 'v_call_genotyped' else: v_call = 'v_call' if model is None: model_ = 'ham' else: model_ = model if normalize_method is None: norm_ = 'len' else: norm_ = normalize_method if threshold_method is None: threshold_method_ = "density" else: threshold_method_ = threshold_method if subsample is None: subsample_ = NULL else: subsample_ = subsample if ncpu is None: ncpu_ = multiprocessing.cpu_count()-1 else: ncpu_ = ncpu dat_h = dat[dat['locus'] == 'IGH'] try: dat_h_r = pandas2ri.py2rpy(dat_h) except: dat_h = dat_h.astype(str) dat_h_r = pandas2ri.py2rpy(dat_h) dist_ham = sh.distToNearest(dat_h_r, vCallColumn=v_call, model=model_, normalize=norm_, nproc=ncpu_, *args) # Find threshold using density method dist = np.array(dist_ham['dist_nearest']) if threshold_method_ is 'density': if edge is None: edge_ = 0.9 else: edge_ = edge dist_threshold = sh.findThreshold(FloatVector(dist[~np.isnan(dist)]), method=threshold_method_, subsample = subsample_, edge = edge_) threshold=np.array(dist_threshold.slots['threshold'])[0] if np.isnan(threshold): warnings.warn(UserWarning("Threshold method 'density' did not return with any values. Switching to method = 'gmm'.")) if threshold_model is None: threshold_model_ = "gamma-gamma" else: threshold_model_ = threshold_model if cross is None: cross_ = NULL else: cross_ = cross if cutoff is None: cutoff_ = 'optimal' else: cutoff_ = cutoff if sensitivity is None: sen_ = NULL else: sen_ = sensitivity if specificity is None: spc_ = NULL else: spc_ = specificity dist_threshold = sh.findThreshold(FloatVector(dist[~np.isnan(dist)]), method='gmm', model = threshold_model_, cross = cross_, subsample = subsample_, cutoff = cutoff_, sen = sen_, spc = spc_) threshold=np.array(dist_threshold.slots['threshold'])[0] else: if threshold_model is None: threshold_model_ = "gamma-gamma" else: threshold_model_ = threshold_model if cross is None: cross_ = NULL else: cross_ = cross if cutoff is None: cutoff_ = 'optimal' else: cutoff_ = cutoff if sensitivity is None: sen_ = NULL else: sen_ = sensitivity if specificity is None: spc_ = NULL else: spc_ = specificity dist_threshold = sh.findThreshold(FloatVector(dist[~np.isnan(dist)]), method=threshold_method_, model = threshold_model_, cross = cross_, subsample = subsample_, cutoff = cutoff_, sen = sen_, spc = spc_) threshold=np.array(dist_threshold.slots['threshold'])[0] if np.isnan(threshold): warnings.warn(UserWarning("Automatic thresholding failed. Please visually inspect the resulting distribution fits and choose a threshold value manually.")) # dist_ham = pandas2ri.rpy2py_dataframe(dist_ham) if plot: options.figure_size = figsize if plot_group is None: plot_group = 'sample_id' else: plot_group = plot_group if manual_threshold is None: tr = threshold else: tr = manual_threshold print((ggplot(dist_ham, aes('dist_nearest', fill=str(plot_group))) + theme_bw() + xlab("Grouped Hamming distance") + ylab("Count") + geom_histogram(binwidth = 0.01) + geom_vline(xintercept = tr, linetype = "dashed", color="blue", size=0.5) + annotate('text', x=tr+0.02, y = 10, label='Threshold:\n' + str(np.around(tr, decimals=2)), size = 8, color = 'Blue') + facet_wrap('~'+str(plot_group), scales="free_y") + theme(legend_position = 'none'))) else: print('Automatic Threshold : '+str(np.around(threshold, decimals=2), '\n method = '+str(threshold_method))) if self.__class__ == Dandelion: self.threshold = tr logg.info(' finished', time=start, deep=('Updated Dandelion object: \n' ' \'threshold\', threshold value for tuning clonal assignment\n')) else: output = Dandelion(dat) output.threshold = tr return(output)